\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601350335:

Variant ID: vg0601350335 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1350335
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATGGAATTCCGAATAACTGATTTTGCTCTGGAAGTCTAAATTCTTGTTTTATTAATTCAGATTAGAAGAATTATTAAAGGTATTGTGACTCAGCGTA[T/C]
TTTTCTACCTCTACATGCCTAGGTCCTATATATGCATGTAAAAATATCTCAAAAAGATGATGTTTGAAATTTTAAGAGTACAAACTTCAAACGAATTTTC

Reverse complement sequence

GAAAATTCGTTTGAAGTTTGTACTCTTAAAATTTCAAACATCATCTTTTTGAGATATTTTTACATGCATATATAGGACCTAGGCATGTAGAGGTAGAAAA[A/G]
TACGCTGAGTCACAATACCTTTAATAATTCTTCTAATCTGAATTAATAAAACAAGAATTTAGACTTCCAGAGCAAAATCAGTTATTCGGAATTCCATATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 6.10% 3.00% 55.21% NA
All Indica  2759 18.70% 7.90% 2.97% 70.42% NA
All Japonica  1512 72.10% 1.60% 1.46% 24.87% NA
Aus  269 3.30% 12.30% 9.29% 75.09% NA
Indica I  595 1.50% 5.40% 4.03% 89.08% NA
Indica II  465 50.30% 4.10% 3.23% 42.37% NA
Indica III  913 14.00% 9.00% 1.86% 75.14% NA
Indica Intermediate  786 18.60% 10.70% 3.31% 67.43% NA
Temperate Japonica  767 85.40% 0.00% 0.26% 14.34% NA
Tropical Japonica  504 50.20% 4.40% 3.57% 41.87% NA
Japonica Intermediate  241 75.50% 0.80% 0.83% 22.82% NA
VI/Aromatic  96 34.40% 6.20% 3.12% 56.25% NA
Intermediate  90 44.40% 6.70% 11.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601350335 T -> C LOC_Os06g03514.2 upstream_gene_variant ; 3839.0bp to feature; MODIFIER silent_mutation Average:33.939; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0601350335 T -> C LOC_Os06g03500.1 intron_variant ; MODIFIER silent_mutation Average:33.939; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0601350335 T -> DEL N N silent_mutation Average:33.939; most accessible tissue: Minghui63 root, score: 52.955 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601350335 NA 4.80E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 1.00E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 2.30E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 9.57E-08 6.69E-18 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 4.40E-17 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 1.29E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 6.13E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 8.17E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 1.19E-11 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 1.26E-12 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 9.73E-16 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 8.61E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 1.05E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 2.64E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 8.03E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 2.60E-16 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 8.69E-20 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 1.20E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 9.22E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 4.82E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 5.18E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 7.56E-06 2.50E-17 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 1.02E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 5.29E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 6.03E-13 mr1399_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 4.01E-07 mr1399_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 2.21E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 5.79E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335 NA 1.30E-09 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251