Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601350335:

Variant ID: vg0601350335 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 1350335
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATATGGAATTCCGAATAACTGATTTTGCTCTGGAAGTCTAAATTCTTGTTTTATTAATTCAGATTAGAAGAATTATTAAAGGTATTGTGACTCAGCGTA[T/C]
TTTTCTACCTCTACATGCCTAGGTCCTATATATGCATGTAAAAATATCTCAAAAAGATGATGTTTGAAATTTTAAGAGTACAAACTTCAAACGAATTTTC

Reverse complement sequence

GAAAATTCGTTTGAAGTTTGTACTCTTAAAATTTCAAACATCATCTTTTTGAGATATTTTTACATGCATATATAGGACCTAGGCATGTAGAGGTAGAAAA[A/G]
TACGCTGAGTCACAATACCTTTAATAATTCTTCTAATCTGAATTAATAAAACAAGAATTTAGACTTCCAGAGCAAAATCAGTTATTCGGAATTCCATATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.70%	6.10%	3.00%	55.21%	NA
All Indica	2759	18.70%	7.90%	2.97%	70.42%	NA
All Japonica	1512	72.10%	1.60%	1.46%	24.87%	NA
Aus	269	3.30%	12.30%	9.29%	75.09%	NA
Indica I	595	1.50%	5.40%	4.03%	89.08%	NA
Indica II	465	50.30%	4.10%	3.23%	42.37%	NA
Indica III	913	14.00%	9.00%	1.86%	75.14%	NA
Indica Intermediate	786	18.60%	10.70%	3.31%	67.43%	NA
Temperate Japonica	767	85.40%	0.00%	0.26%	14.34%	NA
Tropical Japonica	504	50.20%	4.40%	3.57%	41.87%	NA
Japonica Intermediate	241	75.50%	0.80%	0.83%	22.82%	NA
VI/Aromatic	96	34.40%	6.20%	3.12%	56.25%	NA
Intermediate	90	44.40%	6.70%	11.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601350335	T -> C	LOC_Os06g03514.2	upstream_gene_variant ; 3839.0bp to feature; MODIFIER	silent_mutation	Average:33.939; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0601350335	T -> C	LOC_Os06g03500.1	intron_variant ; MODIFIER	silent_mutation	Average:33.939; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0601350335	T -> DEL	N	N	silent_mutation	Average:33.939; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601350335	NA	4.80E-15	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	1.00E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	2.30E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	9.57E-08	6.69E-18	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	4.40E-17	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	1.29E-16	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	6.13E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	8.17E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	1.19E-11	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	1.26E-12	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	9.73E-16	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	8.61E-16	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	1.05E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	2.64E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	8.03E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	2.60E-16	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	8.69E-20	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	1.20E-09	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	9.22E-08	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	4.82E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	5.18E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	7.56E-06	2.50E-17	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	1.02E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	5.29E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	6.03E-13	mr1399_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	4.01E-07	mr1399_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	2.21E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	5.79E-06	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601350335	NA	1.30E-09	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251