\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600884899:

Variant ID: vg0600884899 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 884899
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAAAAAGAGGAGTATGTGCTAGTTAATTGTATATATGCATATATGTCGTGTGATAAGAAACATAAAAAAAATGGTCGCACACAAAGAAAGTAAGACCCT[A/G]
TTTAGATGGGACTAAAACTTTTAAGTCCCTATCACATCGGATGTTTGGACACTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATTCATAATC

Reverse complement sequence

GATTATGAATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAGTGTCCAAACATCCGATGTGATAGGGACTTAAAAGTTTTAGTCCCATCTAAA[T/C]
AGGGTCTTACTTTCTTTGTGTGCGACCATTTTTTTTATGTTTCTTATCACACGACATATATGCATATATACAATTAACTAGCACATACTCCTCTTTTTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 14.90% 0.06% 0.00% NA
All Indica  2759 86.30% 13.70% 0.07% 0.00% NA
All Japonica  1512 82.10% 17.90% 0.00% 0.00% NA
Aus  269 90.30% 9.30% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 81.50% 18.50% 0.00% 0.00% NA
Indica III  913 80.40% 19.60% 0.00% 0.00% NA
Indica Intermediate  786 85.50% 14.20% 0.25% 0.00% NA
Temperate Japonica  767 82.30% 17.70% 0.00% 0.00% NA
Tropical Japonica  504 75.60% 24.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600884899 A -> G LOC_Os06g02540.1 upstream_gene_variant ; 4364.0bp to feature; MODIFIER silent_mutation Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0600884899 A -> G LOC_Os06g02550.1 upstream_gene_variant ; 931.0bp to feature; MODIFIER silent_mutation Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0600884899 A -> G LOC_Os06g02555.1 upstream_gene_variant ; 2999.0bp to feature; MODIFIER silent_mutation Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0600884899 A -> G LOC_Os06g02540.2 upstream_gene_variant ; 4364.0bp to feature; MODIFIER silent_mutation Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0600884899 A -> G LOC_Os06g02550.2 upstream_gene_variant ; 931.0bp to feature; MODIFIER silent_mutation Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0600884899 A -> G LOC_Os06g02540-LOC_Os06g02550 intergenic_region ; MODIFIER silent_mutation Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600884899 NA 1.66E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 8.59E-06 2.04E-08 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 7.61E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 7.26E-06 mr1504 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 6.38E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 2.14E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 8.78E-12 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 1.27E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 2.97E-07 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 4.31E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 7.04E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 8.54E-06 1.36E-09 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 4.67E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 1.11E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 5.83E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 4.02E-06 mr1338_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 3.15E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 1.67E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 6.26E-06 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 1.13E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899 NA 9.36E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251