Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600884899:

Variant ID: vg0600884899 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 884899
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAAAAAGAGGAGTATGTGCTAGTTAATTGTATATATGCATATATGTCGTGTGATAAGAAACATAAAAAAAATGGTCGCACACAAAGAAAGTAAGACCCT[A/G]
TTTAGATGGGACTAAAACTTTTAAGTCCCTATCACATCGGATGTTTGGACACTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATTCATAATC

Reverse complement sequence

GATTATGAATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAGTGTCCAAACATCCGATGTGATAGGGACTTAAAAGTTTTAGTCCCATCTAAA[T/C]
AGGGTCTTACTTTCTTTGTGTGCGACCATTTTTTTTATGTTTCTTATCACACGACATATATGCATATATACAATTAACTAGCACATACTCCTCTTTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.10%	14.90%	0.06%	0.00%	NA
All Indica	2759	86.30%	13.70%	0.07%	0.00%	NA
All Japonica	1512	82.10%	17.90%	0.00%	0.00%	NA
Aus	269	90.30%	9.30%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	81.50%	18.50%	0.00%	0.00%	NA
Indica III	913	80.40%	19.60%	0.00%	0.00%	NA
Indica Intermediate	786	85.50%	14.20%	0.25%	0.00%	NA
Temperate Japonica	767	82.30%	17.70%	0.00%	0.00%	NA
Tropical Japonica	504	75.60%	24.40%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600884899	A -> G	LOC_Os06g02540.1	upstream_gene_variant ; 4364.0bp to feature; MODIFIER	silent_mutation	Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg0600884899	A -> G	LOC_Os06g02550.1	upstream_gene_variant ; 931.0bp to feature; MODIFIER	silent_mutation	Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg0600884899	A -> G	LOC_Os06g02555.1	upstream_gene_variant ; 2999.0bp to feature; MODIFIER	silent_mutation	Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg0600884899	A -> G	LOC_Os06g02540.2	upstream_gene_variant ; 4364.0bp to feature; MODIFIER	silent_mutation	Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg0600884899	A -> G	LOC_Os06g02550.2	upstream_gene_variant ; 931.0bp to feature; MODIFIER	silent_mutation	Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg0600884899	A -> G	LOC_Os06g02540-LOC_Os06g02550	intergenic_region ; MODIFIER	silent_mutation	Average:61.209; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600884899	NA	1.66E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	8.59E-06	2.04E-08	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	7.61E-09	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	7.26E-06	mr1504	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	6.38E-09	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	2.14E-09	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	8.78E-12	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	1.27E-09	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	2.97E-07	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	4.31E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	7.04E-06	mr1321_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	8.54E-06	1.36E-09	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	4.67E-06	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	1.11E-06	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	5.83E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	4.02E-06	mr1338_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	3.15E-06	mr1449_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	1.67E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	6.26E-06	mr1623_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	1.13E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600884899	NA	9.36E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251