\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600822160:

Variant ID: vg0600822160 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 822160
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCTCTGAACTATTCCATTGATTTTTCGACCATCGCCTTCTATGTGGAATGCATGATCATCTTAATTTCGAGATATTCTTCTTTTTCGATAATGGAAG[C/T]
TTTATTAAAACTCAGTCAAATACACCAAGATGATACATTCTAACTGAGCTCACTCCCGGCCTCTGCATGAAATGCACACAGCTACAAAACATGATCTAAC

Reverse complement sequence

GTTAGATCATGTTTTGTAGCTGTGTGCATTTCATGCAGAGGCCGGGAGTGAGCTCAGTTAGAATGTATCATCTTGGTGTATTTGACTGAGTTTTAATAAA[G/A]
CTTCCATTATCGAAAAAGAAGAATATCTCGAAATTAAGATGATCATGCATTCCACATAGAAGGCGATGGTCGAAAAATCAATGGAATAGTTCAGAGAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.80% 1.20% 0.00% 0.00% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.00% 8.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600822160 C -> T LOC_Os06g02400.1 upstream_gene_variant ; 3361.0bp to feature; MODIFIER silent_mutation Average:53.529; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0600822160 C -> T LOC_Os06g02390.1 downstream_gene_variant ; 1804.0bp to feature; MODIFIER silent_mutation Average:53.529; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0600822160 C -> T LOC_Os06g02390-LOC_Os06g02400 intergenic_region ; MODIFIER silent_mutation Average:53.529; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600822160 NA 5.83E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 1.45E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 1.21E-08 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 1.26E-06 1.26E-06 mr1663 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 3.71E-06 1.03E-14 mr1889 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 7.70E-13 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 2.16E-11 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 9.19E-17 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 2.30E-13 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 8.79E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 9.36E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 3.59E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 7.85E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 8.59E-09 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 1.14E-08 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 8.04E-09 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600822160 NA 1.81E-10 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251