\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600688589:

Variant ID: vg0600688589 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 688589
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAAACTAAAATTCAGGGGTATGTAAGGGATTGAGCAAAATTCAGGGTATAGAAGGGATTAGGTGAACTTTCAAGGGTACACAGGGGATTTTCTCTTTC[T/A]
GCTGTGATGTCTTATTGACATGGCATAATAGACACTACTTATAGACATTATGGGTTGGGACTGCACTTATACGTTAGTACAGAGCTTTGATTGATCGTCA

Reverse complement sequence

TGACGATCAATCAAAGCTCTGTACTAACGTATAAGTGCAGTCCCAACCCATAATGTCTATAAGTAGTGTCTATTATGCCATGTCAATAAGACATCACAGC[A/T]
GAAAGAGAAAATCCCCTGTGTACCCTTGAAAGTTCACCTAATCCCTTCTATACCCTGAATTTTGCTCAATCCCTTACATACCCCTGAATTTTAGTTTGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.10% 0.78% 0.06% NA
All Indica  2759 49.80% 49.50% 0.65% 0.00% NA
All Japonica  1512 96.80% 2.40% 0.66% 0.13% NA
Aus  269 96.70% 0.40% 2.60% 0.37% NA
Indica I  595 55.30% 44.00% 0.67% 0.00% NA
Indica II  465 67.10% 32.50% 0.43% 0.00% NA
Indica III  913 34.60% 64.80% 0.55% 0.00% NA
Indica Intermediate  786 53.10% 46.10% 0.89% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 91.10% 6.50% 1.98% 0.40% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600688589 T -> A LOC_Os06g02220.1 upstream_gene_variant ; 4165.0bp to feature; MODIFIER silent_mutation Average:72.408; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0600688589 T -> A LOC_Os06g02210-LOC_Os06g02220 intergenic_region ; MODIFIER silent_mutation Average:72.408; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0600688589 T -> DEL N N silent_mutation Average:72.408; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0600688589 T A 0.02 0.02 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600688589 NA 1.55E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600688589 3.57E-07 NA mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600688589 4.02E-08 1.60E-09 mr1063 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600688589 NA 2.15E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600688589 NA 7.15E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600688589 NA 3.82E-07 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600688589 NA 5.85E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600688589 NA 5.92E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251