Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0600686096:

Variant ID: vg0600686096 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 686096
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, T: 0.21, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGAGTTTTTGTTTATAATGTTTGACCATTCGTCTTATTCAATTTTTTTTTAAATTATTATTTATTTTATTTGTGACTTACTTTATTATTCACAGTACT[G/T]
TAAGCACAACTTTTCGTTTTTTATATTTGTAAAAAAAAATTAAATAAGACGAGTGGTCAAACGTTATCAGTATAAACTCAAAATCCCTTATATTATGGGA

Reverse complement sequence

TCCCATAATATAAGGGATTTTGAGTTTATACTGATAACGTTTGACCACTCGTCTTATTTAATTTTTTTTTACAAATATAAAAAACGAAAAGTTGTGCTTA[C/A]
AGTACTGTGAATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTAAAAAAAAATTGAATAAGACGAATGGTCAAACATTATAAACAAAAACTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.10%	33.90%	0.49%	0.47%	NA
All Indica	2759	47.30%	51.90%	0.62%	0.11%	NA
All Japonica	1512	96.40%	2.60%	0.13%	0.79%	NA
Aus	269	85.50%	11.90%	0.00%	2.60%	NA
Indica I	595	57.60%	41.50%	0.67%	0.17%	NA
Indica II	465	63.70%	35.70%	0.65%	0.00%	NA
Indica III	913	29.40%	69.90%	0.66%	0.11%	NA
Indica Intermediate	786	50.80%	48.60%	0.51%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	90.50%	6.70%	0.40%	2.38%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	21.90%	77.10%	1.04%	0.00%	NA
Intermediate	90	68.90%	27.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600686096	G -> T	LOC_Os06g02210.1	upstream_gene_variant ; 3299.0bp to feature; MODIFIER	silent_mutation	Average:57.653; most accessible tissue: Zhenshan97 panicle, score: 96.894	N	N	N	N
vg0600686096	G -> T	LOC_Os06g02210-LOC_Os06g02220	intergenic_region ; MODIFIER	silent_mutation	Average:57.653; most accessible tissue: Zhenshan97 panicle, score: 96.894	N	N	N	N
vg0600686096	G -> DEL	N	N	silent_mutation	Average:57.653; most accessible tissue: Zhenshan97 panicle, score: 96.894	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0600686096	G	T	0.0	0.0	-0.01	0.01	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600686096	NA	7.10E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	4.05E-06	2.18E-07	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	9.86E-12	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	2.89E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	9.70E-06	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	5.95E-06	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	1.45E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	5.22E-08	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	6.67E-08	mr1743	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	2.37E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	1.98E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	3.19E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096	NA	2.84E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251