\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600686096:

Variant ID: vg0600686096 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 686096
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, T: 0.21, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAGTTTTTGTTTATAATGTTTGACCATTCGTCTTATTCAATTTTTTTTTAAATTATTATTTATTTTATTTGTGACTTACTTTATTATTCACAGTACT[G/T]
TAAGCACAACTTTTCGTTTTTTATATTTGTAAAAAAAAATTAAATAAGACGAGTGGTCAAACGTTATCAGTATAAACTCAAAATCCCTTATATTATGGGA

Reverse complement sequence

TCCCATAATATAAGGGATTTTGAGTTTATACTGATAACGTTTGACCACTCGTCTTATTTAATTTTTTTTTACAAATATAAAAAACGAAAAGTTGTGCTTA[C/A]
AGTACTGTGAATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTAAAAAAAAATTGAATAAGACGAATGGTCAAACATTATAAACAAAAACTCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 33.90% 0.49% 0.47% NA
All Indica  2759 47.30% 51.90% 0.62% 0.11% NA
All Japonica  1512 96.40% 2.60% 0.13% 0.79% NA
Aus  269 85.50% 11.90% 0.00% 2.60% NA
Indica I  595 57.60% 41.50% 0.67% 0.17% NA
Indica II  465 63.70% 35.70% 0.65% 0.00% NA
Indica III  913 29.40% 69.90% 0.66% 0.11% NA
Indica Intermediate  786 50.80% 48.60% 0.51% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 90.50% 6.70% 0.40% 2.38% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 77.10% 1.04% 0.00% NA
Intermediate  90 68.90% 27.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600686096 G -> T LOC_Os06g02210.1 upstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:57.653; most accessible tissue: Zhenshan97 panicle, score: 96.894 N N N N
vg0600686096 G -> T LOC_Os06g02210-LOC_Os06g02220 intergenic_region ; MODIFIER silent_mutation Average:57.653; most accessible tissue: Zhenshan97 panicle, score: 96.894 N N N N
vg0600686096 G -> DEL N N silent_mutation Average:57.653; most accessible tissue: Zhenshan97 panicle, score: 96.894 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0600686096 G T 0.0 0.0 -0.01 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600686096 NA 7.10E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 4.05E-06 2.18E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 9.86E-12 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 2.89E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 9.70E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 5.95E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 1.45E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 5.22E-08 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 6.67E-08 mr1743 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 2.37E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 1.98E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 3.19E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600686096 NA 2.84E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251