\
| Variant ID: vg0600544648 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 544648 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )
GTTACTACAATATCAGAAACTTATTATAATATAAAATTGATTGTTGGAATTTGATAAGTTTGACCGAATCTTGTCCTAAACGTCAAATATTTTTTGAACA[A/G]
AGGGAGTAATTTGGTAGAGAATCGACCCAAACTTGTTATACATGGAGTAAACCAACCATTTTTTTGGCAAAAGTAGGAAGAATCCTTCAGCCACTAAACC
GGTTTAGTGGCTGAAGGATTCTTCCTACTTTTGCCAAAAAAATGGTTGGTTTACTCCATGTATAACAAGTTTGGGTCGATTCTCTACCAAATTACTCCCT[T/C]
TGTTCAAAAAATATTTGACGTTTAGGACAAGATTCGGTCAAACTTATCAAATTCCAACAATCAATTTTATATTATAATAAGTTTCTGATATTGTAGTAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 16.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 72.70% | 27.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.10% | 53.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 78.30% | 21.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.70% | 10.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0600544648 | A -> G | LOC_Os06g01972.1 | upstream_gene_variant ; 1856.0bp to feature; MODIFIER | silent_mutation | Average:33.24; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg0600544648 | A -> G | LOC_Os06g01966.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.24; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0600544648 | NA | 4.47E-11 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | 2.10E-06 | 1.27E-11 | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | NA | 2.50E-06 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | NA | 1.32E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | NA | 4.72E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | NA | 3.60E-06 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | NA | 5.24E-11 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | NA | 7.66E-06 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | NA | 3.61E-14 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600544648 | NA | 4.34E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |