\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600544648:

Variant ID: vg0600544648 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 544648
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GTTACTACAATATCAGAAACTTATTATAATATAAAATTGATTGTTGGAATTTGATAAGTTTGACCGAATCTTGTCCTAAACGTCAAATATTTTTTGAACA[A/G]
AGGGAGTAATTTGGTAGAGAATCGACCCAAACTTGTTATACATGGAGTAAACCAACCATTTTTTTGGCAAAAGTAGGAAGAATCCTTCAGCCACTAAACC

Reverse complement sequence

GGTTTAGTGGCTGAAGGATTCTTCCTACTTTTGCCAAAAAAATGGTTGGTTTACTCCATGTATAACAAGTTTGGGTCGATTCTCTACCAAATTACTCCCT[T/C]
TGTTCAAAAAATATTTGACGTTTAGGACAAGATTCGGTCAAACTTATCAAATTCCAACAATCAATTTTATATTATAATAAGTTTCTGATATTGTAGTAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 16.00% 0.04% 0.00% NA
All Indica  2759 72.70% 27.20% 0.07% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 46.10% 53.80% 0.17% 0.00% NA
Indica II  465 78.30% 21.70% 0.00% 0.00% NA
Indica III  913 89.70% 10.20% 0.11% 0.00% NA
Indica Intermediate  786 69.80% 30.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600544648 A -> G LOC_Os06g01972.1 upstream_gene_variant ; 1856.0bp to feature; MODIFIER silent_mutation Average:33.24; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N
vg0600544648 A -> G LOC_Os06g01966.1 intron_variant ; MODIFIER silent_mutation Average:33.24; most accessible tissue: Zhenshan97 flower, score: 47.586 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600544648 NA 4.47E-11 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 2.10E-06 1.27E-11 mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 NA 2.50E-06 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 NA 1.32E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 NA 4.72E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 NA 3.60E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 NA 5.24E-11 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 NA 7.66E-06 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 NA 3.61E-14 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648 NA 4.34E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251