Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0600544648:

Variant ID: vg0600544648 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 544648
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GTTACTACAATATCAGAAACTTATTATAATATAAAATTGATTGTTGGAATTTGATAAGTTTGACCGAATCTTGTCCTAAACGTCAAATATTTTTTGAACA[A/G]
AGGGAGTAATTTGGTAGAGAATCGACCCAAACTTGTTATACATGGAGTAAACCAACCATTTTTTTGGCAAAAGTAGGAAGAATCCTTCAGCCACTAAACC

Reverse complement sequence

GGTTTAGTGGCTGAAGGATTCTTCCTACTTTTGCCAAAAAAATGGTTGGTTTACTCCATGTATAACAAGTTTGGGTCGATTCTCTACCAAATTACTCCCT[T/C]
TGTTCAAAAAATATTTGACGTTTAGGACAAGATTCGGTCAAACTTATCAAATTCCAACAATCAATTTTATATTATAATAAGTTTCTGATATTGTAGTAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.00%	16.00%	0.04%	0.00%	NA
All Indica	2759	72.70%	27.20%	0.07%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	46.10%	53.80%	0.17%	0.00%	NA
Indica II	465	78.30%	21.70%	0.00%	0.00%	NA
Indica III	913	89.70%	10.20%	0.11%	0.00%	NA
Indica Intermediate	786	69.80%	30.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600544648	A -> G	LOC_Os06g01972.1	upstream_gene_variant ; 1856.0bp to feature; MODIFIER	silent_mutation	Average:33.24; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N
vg0600544648	A -> G	LOC_Os06g01966.1	intron_variant ; MODIFIER	silent_mutation	Average:33.24; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600544648	NA	4.47E-11	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	2.10E-06	1.27E-11	mr1728	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	NA	2.50E-06	mr1728	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	NA	1.32E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	NA	4.72E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	NA	3.60E-06	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	NA	5.24E-11	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	NA	7.66E-06	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	NA	3.61E-14	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600544648	NA	4.34E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251