\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600327755:

Variant ID: vg0600327755 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 327755
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTCTTTTTCTTTTCCAAAAAGGATTTAATTAAATCCTTTTCCTTTAGATAAAAAATTCAATAATCTTAGAAATTCAATATCTTCCCAACCGTAAATCC[G/A]
TTTGACTCCGTTCAACTTCCAAAATTCCCCAAATCTCGAGATCGATCTTATGGCACGCTTAGAGGTCGTTAATAGGGCTTTATTTTTGCCGTTTGTTGAG

Reverse complement sequence

CTCAACAAACGGCAAAAATAAAGCCCTATTAACGACCTCTAAGCGTGCCATAAGATCGATCTCGAGATTTGGGGAATTTTGGAAGTTGAACGGAGTCAAA[C/T]
GGATTTACGGTTGGGAAGATATTGAATTTCTAAGATTATTGAATTTTTTATCTAAAGGAAAAGGATTTAATTAAATCCTTTTTGGAAAAGAAAAAGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.50% 2.60% 18.51% 44.41% NA
All Indica  2759 8.10% 0.10% 27.15% 64.70% NA
All Japonica  1512 88.00% 7.50% 2.31% 2.18% NA
Aus  269 2.60% 0.00% 28.62% 68.77% NA
Indica I  595 0.70% 0.00% 14.29% 85.04% NA
Indica II  465 15.90% 0.20% 13.33% 70.54% NA
Indica III  913 6.60% 0.10% 46.55% 46.77% NA
Indica Intermediate  786 10.80% 0.00% 22.52% 66.67% NA
Temperate Japonica  767 99.30% 0.50% 0.00% 0.13% NA
Tropical Japonica  504 67.10% 21.20% 6.75% 4.96% NA
Japonica Intermediate  241 95.40% 1.20% 0.41% 2.90% NA
VI/Aromatic  96 22.90% 1.00% 4.17% 71.88% NA
Intermediate  90 52.20% 6.70% 11.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600327755 G -> A LOC_Os06g01560.1 upstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600327755 G -> A LOC_Os06g01534.1 downstream_gene_variant ; 2224.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600327755 G -> A LOC_Os06g01550.1 downstream_gene_variant ; 123.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600327755 G -> A LOC_Os06g01534-LOC_Os06g01550 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600327755 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600327755 NA 4.20E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600327755 1.14E-06 3.36E-11 mr1518 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600327755 NA 9.07E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600327755 NA 2.54E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251