| Variant ID: vg0600327755 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 327755 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTCTTTTTCTTTTCCAAAAAGGATTTAATTAAATCCTTTTCCTTTAGATAAAAAATTCAATAATCTTAGAAATTCAATATCTTCCCAACCGTAAATCC[G/A]
TTTGACTCCGTTCAACTTCCAAAATTCCCCAAATCTCGAGATCGATCTTATGGCACGCTTAGAGGTCGTTAATAGGGCTTTATTTTTGCCGTTTGTTGAG
CTCAACAAACGGCAAAAATAAAGCCCTATTAACGACCTCTAAGCGTGCCATAAGATCGATCTCGAGATTTGGGGAATTTTGGAAGTTGAACGGAGTCAAA[C/T]
GGATTTACGGTTGGGAAGATATTGAATTTCTAAGATTATTGAATTTTTTATCTAAAGGAAAAGGATTTAATTAAATCCTTTTTGGAAAAGAAAAAGAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.50% | 2.60% | 18.51% | 44.41% | NA |
| All Indica | 2759 | 8.10% | 0.10% | 27.15% | 64.70% | NA |
| All Japonica | 1512 | 88.00% | 7.50% | 2.31% | 2.18% | NA |
| Aus | 269 | 2.60% | 0.00% | 28.62% | 68.77% | NA |
| Indica I | 595 | 0.70% | 0.00% | 14.29% | 85.04% | NA |
| Indica II | 465 | 15.90% | 0.20% | 13.33% | 70.54% | NA |
| Indica III | 913 | 6.60% | 0.10% | 46.55% | 46.77% | NA |
| Indica Intermediate | 786 | 10.80% | 0.00% | 22.52% | 66.67% | NA |
| Temperate Japonica | 767 | 99.30% | 0.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 67.10% | 21.20% | 6.75% | 4.96% | NA |
| Japonica Intermediate | 241 | 95.40% | 1.20% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 22.90% | 1.00% | 4.17% | 71.88% | NA |
| Intermediate | 90 | 52.20% | 6.70% | 11.11% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0600327755 | G -> A | LOC_Os06g01560.1 | upstream_gene_variant ; 2978.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0600327755 | G -> A | LOC_Os06g01534.1 | downstream_gene_variant ; 2224.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0600327755 | G -> A | LOC_Os06g01550.1 | downstream_gene_variant ; 123.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0600327755 | G -> A | LOC_Os06g01534-LOC_Os06g01550 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0600327755 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0600327755 | NA | 4.20E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600327755 | 1.14E-06 | 3.36E-11 | mr1518 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600327755 | NA | 9.07E-09 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600327755 | NA | 2.54E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |