Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0600102016:

Variant ID: vg0600102016 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 102016
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTCCGGCGAAGGGATAAGTCCAATGTTTCGCCGGTCCAGGCAATTGTATCATCTACGTCAGCGTCGTTCAAGGCTGCATCAATACATTCGACCTCTTG[A/G]
ATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGCTTCTCGT

Reverse complement sequence

ACGAGAAGCAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAAT[T/C]
CAAGAGGTCGAATGTATTGATGCAGCCTTGAACGACGCTGACGTAGATGATACAATTGCCTGGACCGGCGAAACATTGGACTTATCCCTTCGCCGGAGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.60%	4.90%	6.50%	49.07%	NA
All Indica	2759	12.60%	6.90%	8.66%	71.91%	NA
All Japonica	1512	95.20%	0.30%	0.60%	3.90%	NA
Aus	269	4.50%	0.70%	8.18%	86.62%	NA
Indica I	595	8.90%	0.00%	4.37%	86.72%	NA
Indica II	465	10.30%	21.30%	7.10%	61.29%	NA
Indica III	913	13.80%	3.50%	12.81%	69.88%	NA
Indica Intermediate	786	15.30%	7.40%	8.02%	69.34%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	87.30%	0.80%	1.19%	10.71%	NA
Japonica Intermediate	241	96.30%	0.40%	1.24%	2.07%	NA
VI/Aromatic	96	24.00%	25.00%	29.17%	21.88%	NA
Intermediate	90	54.40%	11.10%	10.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600102016	A -> G	LOC_Os06g01090.1	upstream_gene_variant ; 520.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0600102016	A -> G	LOC_Os06g01100.1	downstream_gene_variant ; 4067.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0600102016	A -> G	LOC_Os06g01090-LOC_Os06g01100	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0600102016	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600102016	5.05E-07	5.03E-07	mr1267	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600102016	NA	2.85E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600102016	NA	4.80E-09	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251