\
| Variant ID: vg0600102016 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 102016 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 80. )
ATCTCCGGCGAAGGGATAAGTCCAATGTTTCGCCGGTCCAGGCAATTGTATCATCTACGTCAGCGTCGTTCAAGGCTGCATCAATACATTCGACCTCTTG[A/G]
ATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGCTTCTCGT
ACGAGAAGCAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAAT[T/C]
CAAGAGGTCGAATGTATTGATGCAGCCTTGAACGACGCTGACGTAGATGATACAATTGCCTGGACCGGCGAAACATTGGACTTATCCCTTCGCCGGAGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.60% | 4.90% | 6.50% | 49.07% | NA |
| All Indica | 2759 | 12.60% | 6.90% | 8.66% | 71.91% | NA |
| All Japonica | 1512 | 95.20% | 0.30% | 0.60% | 3.90% | NA |
| Aus | 269 | 4.50% | 0.70% | 8.18% | 86.62% | NA |
| Indica I | 595 | 8.90% | 0.00% | 4.37% | 86.72% | NA |
| Indica II | 465 | 10.30% | 21.30% | 7.10% | 61.29% | NA |
| Indica III | 913 | 13.80% | 3.50% | 12.81% | 69.88% | NA |
| Indica Intermediate | 786 | 15.30% | 7.40% | 8.02% | 69.34% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.30% | 0.80% | 1.19% | 10.71% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.40% | 1.24% | 2.07% | NA |
| VI/Aromatic | 96 | 24.00% | 25.00% | 29.17% | 21.88% | NA |
| Intermediate | 90 | 54.40% | 11.10% | 10.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0600102016 | A -> G | LOC_Os06g01090.1 | upstream_gene_variant ; 520.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0600102016 | A -> G | LOC_Os06g01100.1 | downstream_gene_variant ; 4067.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0600102016 | A -> G | LOC_Os06g01090-LOC_Os06g01100 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0600102016 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0600102016 | 5.05E-07 | 5.03E-07 | mr1267 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600102016 | NA | 2.85E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600102016 | NA | 4.80E-09 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |