\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600102016:

Variant ID: vg0600102016 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 102016
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCCGGCGAAGGGATAAGTCCAATGTTTCGCCGGTCCAGGCAATTGTATCATCTACGTCAGCGTCGTTCAAGGCTGCATCAATACATTCGACCTCTTG[A/G]
ATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGCTTCTCGT

Reverse complement sequence

ACGAGAAGCAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAAT[T/C]
CAAGAGGTCGAATGTATTGATGCAGCCTTGAACGACGCTGACGTAGATGATACAATTGCCTGGACCGGCGAAACATTGGACTTATCCCTTCGCCGGAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 4.90% 6.50% 49.07% NA
All Indica  2759 12.60% 6.90% 8.66% 71.91% NA
All Japonica  1512 95.20% 0.30% 0.60% 3.90% NA
Aus  269 4.50% 0.70% 8.18% 86.62% NA
Indica I  595 8.90% 0.00% 4.37% 86.72% NA
Indica II  465 10.30% 21.30% 7.10% 61.29% NA
Indica III  913 13.80% 3.50% 12.81% 69.88% NA
Indica Intermediate  786 15.30% 7.40% 8.02% 69.34% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 0.80% 1.19% 10.71% NA
Japonica Intermediate  241 96.30% 0.40% 1.24% 2.07% NA
VI/Aromatic  96 24.00% 25.00% 29.17% 21.88% NA
Intermediate  90 54.40% 11.10% 10.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0600102016 A -> G LOC_Os06g01090.1 upstream_gene_variant ; 520.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600102016 A -> G LOC_Os06g01100.1 downstream_gene_variant ; 4067.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600102016 A -> G LOC_Os06g01090-LOC_Os06g01100 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0600102016 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0600102016 5.05E-07 5.03E-07 mr1267 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600102016 NA 2.85E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600102016 NA 4.80E-09 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251