\
| Variant ID: vg0600020896 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20896 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 241. )
TATCTGAGGGTCCACAACTGGTTTTCAACGAGGTGGTTAGTATAGGGATGGCACATAGGACATTAGGGTGGATAGCATAGACGATGTCGGTGTCAAGCGC[G/A]
TCGACTAACCGCGTCGTTAACGTAGGCAGGCGGGCACGACACTGTGGAATGCAGATGGAGAATTCTGTGCAAATTAAAACCTTGATAACTTTGCCTTCCG
CGGAAGGCAAAGTTATCAAGGTTTTAATTTGCACAGAATTCTCCATCTGCATTCCACAGTGTCGTGCCCGCCTGCCTACGTTAACGACGCGGTTAGTCGA[C/T]
GCGCTTGACACCGACATCGTCTATGCTATCCACCCTAATGTCCTATGTGCCATCCCTATACTAACCACCTCGTTGAAAACCAGTTGTGGACCCTCAGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.90% | 1.90% | 9.88% | 18.26% | NA |
| All Indica | 2759 | 57.70% | 0.70% | 13.34% | 28.27% | NA |
| All Japonica | 1512 | 88.60% | 4.50% | 4.70% | 2.18% | NA |
| Aus | 269 | 83.60% | 0.00% | 4.83% | 11.52% | NA |
| Indica I | 595 | 54.30% | 0.00% | 22.02% | 23.70% | NA |
| Indica II | 465 | 55.90% | 0.20% | 13.55% | 30.32% | NA |
| Indica III | 913 | 62.90% | 0.70% | 6.24% | 30.23% | NA |
| Indica Intermediate | 786 | 55.20% | 1.70% | 14.89% | 28.24% | NA |
| Temperate Japonica | 767 | 95.80% | 0.40% | 3.52% | 0.26% | NA |
| Tropical Japonica | 504 | 77.40% | 10.90% | 6.55% | 5.16% | NA |
| Japonica Intermediate | 241 | 89.20% | 4.10% | 4.56% | 2.07% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 4.17% | 11.46% | NA |
| Intermediate | 90 | 75.60% | 3.30% | 12.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0600020896 | G -> A | LOC_Os06g01040.1 | synonymous_variant ; p.Asp399Asp; LOW | synonymous_codon | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0600020896 | G -> DEL | LOC_Os06g01040.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0600020896 | 1.88E-06 | 4.05E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 1.34E-06 | 3.26E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 9.62E-08 | 6.15E-08 | mr1119 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 4.58E-06 | 1.54E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 8.16E-07 | 1.99E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 3.76E-08 | 1.23E-07 | mr1496 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 1.14E-06 | 1.72E-08 | mr1961 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | NA | 9.59E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | NA | 6.24E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 1.22E-07 | 2.94E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 2.15E-07 | 2.91E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0600020896 | 2.29E-07 | 5.75E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |