\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529568293:

Variant ID: vg0529568293 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 29568293
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGAATAGATTACTATGAATCTCTTGGAAAGTCATTGAAAATTGTCTGGACCTTTATTAAAAATTGTTTGAACCTTTATCAAAAATTGTTGTAAATTC[G/A]
GTTCATCAATCATGTTTTCCAAGTGATTATCTGTGTTGTGATTCTGCATGTAGCAGCTGCACAAATTGTGATTTGGTTTGATATCTTGCAAGAGAGAGGC

Reverse complement sequence

GCCTCTCTCTTGCAAGATATCAAACCAAATCACAATTTGTGCAGCTGCTACATGCAGAATCACAACACAGATAATCACTTGGAAAACATGATTGATGAAC[C/T]
GAATTTACAACAATTTTTGATAAAGGTTCAAACAATTTTTAATAAAGGTCCAGACAATTTTCAATGACTTTCCAAGAGATTCATAGTAATCTATTCACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.50% 0.00% 0.47% NA
All Indica  2759 95.30% 4.40% 0.00% 0.29% NA
All Japonica  1512 2.40% 97.10% 0.00% 0.53% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 83.90% 15.70% 0.00% 0.43% NA
Indica III  913 99.10% 0.50% 0.00% 0.33% NA
Indica Intermediate  786 95.00% 4.60% 0.00% 0.38% NA
Temperate Japonica  767 0.50% 99.30% 0.00% 0.13% NA
Tropical Japonica  504 5.80% 93.50% 0.00% 0.79% NA
Japonica Intermediate  241 1.20% 97.50% 0.00% 1.24% NA
VI/Aromatic  96 11.50% 87.50% 0.00% 1.04% NA
Intermediate  90 52.20% 42.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0529568293 G -> DEL N N silent_mutation Average:30.505; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0529568293 G -> A LOC_Os05g51560.1 downstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:30.505; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0529568293 G -> A LOC_Os05g51560.3 downstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:30.505; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0529568293 G -> A LOC_Os05g51560.2 downstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:30.505; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0529568293 G -> A LOC_Os05g51550-LOC_Os05g51560 intergenic_region ; MODIFIER silent_mutation Average:30.505; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0529568293 NA 4.24E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 3.97E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 1.14E-29 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 2.46E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 3.06E-06 6.31E-24 mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 1.65E-06 NA mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 3.99E-24 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 1.48E-06 2.07E-07 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 1.53E-52 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 1.91E-51 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 4.25E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 5.38E-17 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 2.87E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 7.41E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 5.05E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 2.54E-07 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 7.92E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 2.91E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 9.85E-47 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 7.33E-06 NA mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 1.39E-31 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 7.05E-07 1.20E-11 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 3.89E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 6.17E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 6.71E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 6.23E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 1.43E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 7.60E-15 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 2.12E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 3.53E-08 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529568293 NA 4.59E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251