Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0528815688:

Variant ID: vg0528815688 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 28815688
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTCGTCGTTGTCGATGGTGTGGTGTGTTGTTGATGGGTGATGGGTTTGCGCCGCTGCATGCCAGTGCGAGGCAGAGCGGCAGCGAGCCTGCGACGCTG[C/T]
GGCTAGTTCCCCCTGCGACGCTGGATCTCCGGTCATGTTAGCATGACGTAGAAGGCGCGGAACAGTCACTAGTCGGGGGTCGTCATTGCCATATATGACG

Reverse complement sequence

CGTCATATATGGCAATGACGACCCCCGACTAGTGACTGTTCCGCGCCTTCTACGTCATGCTAACATGACCGGAGATCCAGCGTCGCAGGGGGAACTAGCC[G/A]
CAGCGTCGCAGGCTCGCTGCCGCTCTGCCTCGCACTGGCATGCAGCGGCGCAAACCCATCACCCATCAACAACACACCACACCATCGACAACGACGACGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.10%	28.60%	0.25%	0.00%	NA
All Indica	2759	98.80%	1.10%	0.11%	0.00%	NA
All Japonica	1512	19.40%	80.40%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	1.70%	0.38%	0.00%	NA
Temperate Japonica	767	0.80%	99.00%	0.26%	0.00%	NA
Tropical Japonica	504	54.60%	45.20%	0.20%	0.00%	NA
Japonica Intermediate	241	5.00%	94.60%	0.41%	0.00%	NA
VI/Aromatic	96	14.60%	84.40%	1.04%	0.00%	NA
Intermediate	90	64.40%	31.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528815688	C -> T	LOC_Os05g50270.1	upstream_gene_variant ; 1917.0bp to feature; MODIFIER	silent_mutation	Average:91.761; most accessible tissue: Zhenshan97 panicle, score: 99.189	N	N	N	N
vg0528815688	C -> T	LOC_Os05g50280.1	downstream_gene_variant ; 3754.0bp to feature; MODIFIER	silent_mutation	Average:91.761; most accessible tissue: Zhenshan97 panicle, score: 99.189	N	N	N	N
vg0528815688	C -> T	LOC_Os05g50260-LOC_Os05g50270	intergenic_region ; MODIFIER	silent_mutation	Average:91.761; most accessible tissue: Zhenshan97 panicle, score: 99.189	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0528815688	C	T	0.0	0.05	0.02	0.04	0.02	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528815688	NA	1.77E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	5.25E-19	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	1.48E-22	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	4.18E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	6.51E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	1.40E-20	mr1304	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	1.30E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	3.26E-30	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	7.07E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	8.04E-21	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	3.44E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	1.02E-23	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	2.42E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	1.01E-12	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528815688	NA	4.00E-23	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251