\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528743315:

Variant ID: vg0528743315 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28743315
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCCACACCATTTTATAATACGGATCATACCAGAATAATTTTATTTTATTTTTTATTTGATGTGGCATAATTTAGGTCTTCTTTTTTTTTTCTCGCACA[T/A]
TAGATGCCACACATGATTCTTCCTGCACTCTAAACGTCATGGCAAAGGACAAAAACTACTGGGAAAGAAAATTAAAGAGTTTCTTTATTGATTATTACAA

Reverse complement sequence

TTGTAATAATCAATAAAGAAACTCTTTAATTTTCTTTCCCAGTAGTTTTTGTCCTTTGCCATGACGTTTAGAGTGCAGGAAGAATCATGTGTGGCATCTA[A/T]
TGTGCGAGAAAAAAAAAAGAAGACCTAAATTATGCCACATCAAATAAAAAATAAAATAAAATTATTCTGGTATGATCCGTATTATAAAATGGTGTGGGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 10.10% 2.07% 0.00% NA
All Indica  2759 99.50% 0.40% 0.07% 0.00% NA
All Japonica  1512 63.80% 30.00% 6.15% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.50% 0.25% 0.00% NA
Temperate Japonica  767 41.90% 49.00% 9.13% 0.00% NA
Tropical Japonica  504 97.60% 1.20% 1.19% 0.00% NA
Japonica Intermediate  241 63.10% 29.90% 7.05% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 94.40% 2.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528743315 T -> A LOC_Os05g50150.1 upstream_gene_variant ; 3668.0bp to feature; MODIFIER silent_mutation Average:52.234; most accessible tissue: Callus, score: 88.627 N N N N
vg0528743315 T -> A LOC_Os05g50160.1 downstream_gene_variant ; 60.0bp to feature; MODIFIER silent_mutation Average:52.234; most accessible tissue: Callus, score: 88.627 N N N N
vg0528743315 T -> A LOC_Os05g50170.1 downstream_gene_variant ; 1974.0bp to feature; MODIFIER silent_mutation Average:52.234; most accessible tissue: Callus, score: 88.627 N N N N
vg0528743315 T -> A LOC_Os05g50170.2 downstream_gene_variant ; 3589.0bp to feature; MODIFIER silent_mutation Average:52.234; most accessible tissue: Callus, score: 88.627 N N N N
vg0528743315 T -> A LOC_Os05g50150-LOC_Os05g50160 intergenic_region ; MODIFIER silent_mutation Average:52.234; most accessible tissue: Callus, score: 88.627 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528743315 NA 3.13E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528743315 1.63E-06 NA mr1680_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528743315 NA 2.11E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528743315 NA 5.36E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251