Variant ID: vg0528743315 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 28743315 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
CCCCCACACCATTTTATAATACGGATCATACCAGAATAATTTTATTTTATTTTTTATTTGATGTGGCATAATTTAGGTCTTCTTTTTTTTTTCTCGCACA[T/A]
TAGATGCCACACATGATTCTTCCTGCACTCTAAACGTCATGGCAAAGGACAAAAACTACTGGGAAAGAAAATTAAAGAGTTTCTTTATTGATTATTACAA
TTGTAATAATCAATAAAGAAACTCTTTAATTTTCTTTCCCAGTAGTTTTTGTCCTTTGCCATGACGTTTAGAGTGCAGGAAGAATCATGTGTGGCATCTA[A/T]
TGTGCGAGAAAAAAAAAAGAAGACCTAAATTATGCCACATCAAATAAAAAATAAAATAAAATTATTCTGGTATGATCCGTATTATAAAATGGTGTGGGGG
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 87.90% | 10.10% | 2.07% | 0.00% | NA |
All Indica | 2759 | 99.50% | 0.40% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 63.80% | 30.00% | 6.15% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.20% | 0.50% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 41.90% | 49.00% | 9.13% | 0.00% | NA |
Tropical Japonica | 504 | 97.60% | 1.20% | 1.19% | 0.00% | NA |
Japonica Intermediate | 241 | 63.10% | 29.90% | 7.05% | 0.00% | NA |
VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 2.20% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0528743315 | T -> A | LOC_Os05g50150.1 | upstream_gene_variant ; 3668.0bp to feature; MODIFIER | silent_mutation | Average:52.234; most accessible tissue: Callus, score: 88.627 | N | N | N | N |
vg0528743315 | T -> A | LOC_Os05g50160.1 | downstream_gene_variant ; 60.0bp to feature; MODIFIER | silent_mutation | Average:52.234; most accessible tissue: Callus, score: 88.627 | N | N | N | N |
vg0528743315 | T -> A | LOC_Os05g50170.1 | downstream_gene_variant ; 1974.0bp to feature; MODIFIER | silent_mutation | Average:52.234; most accessible tissue: Callus, score: 88.627 | N | N | N | N |
vg0528743315 | T -> A | LOC_Os05g50170.2 | downstream_gene_variant ; 3589.0bp to feature; MODIFIER | silent_mutation | Average:52.234; most accessible tissue: Callus, score: 88.627 | N | N | N | N |
vg0528743315 | T -> A | LOC_Os05g50150-LOC_Os05g50160 | intergenic_region ; MODIFIER | silent_mutation | Average:52.234; most accessible tissue: Callus, score: 88.627 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0528743315 | NA | 3.13E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528743315 | 1.63E-06 | NA | mr1680_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528743315 | NA | 2.11E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528743315 | NA | 5.36E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |