\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528415027:

Variant ID: vg0528415027 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28415027
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTTTTTTTCTTTTGATATTCTTTTGTCCACTTCAATTGGGAACTTAGTAGAAGTTGATGGGGATGTGTTGTTGTTGTTGAAGTCAAAGGAAGAAGTG[C/T]
GAGAGAAGAGTATTTGAGACTTTTAGCCTAGAACCCTCTAGAAGTTTGTGCTCTCAAAAGATTTTTTTTTTTCATATATGATCTTATTTACCTGCAAATT

Reverse complement sequence

AATTTGCAGGTAAATAAGATCATATATGAAAAAAAAAAATCTTTTGAGAGCACAAACTTCTAGAGGGTTCTAGGCTAAAAGTCTCAAATACTCTTCTCTC[G/A]
CACTTCTTCCTTTGACTTCAACAACAACAACACATCCCCATCAACTTCTACTAAGTTCCCAATTGAAGTGGACAAAAGAATATCAAAAGAAAAAAAAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 9.00% 11.57% 4.13% NA
All Indica  2759 77.20% 12.50% 10.08% 0.22% NA
All Japonica  1512 65.60% 5.20% 16.73% 12.43% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 93.80% 0.50% 5.38% 0.34% NA
Indica II  465 73.50% 11.40% 14.41% 0.65% NA
Indica III  913 66.50% 23.10% 10.41% 0.00% NA
Indica Intermediate  786 79.30% 9.90% 10.69% 0.13% NA
Temperate Japonica  767 99.10% 0.00% 0.78% 0.13% NA
Tropical Japonica  504 11.90% 12.90% 40.48% 34.72% NA
Japonica Intermediate  241 71.40% 5.80% 17.84% 4.98% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 81.10% 3.30% 14.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528415027 C -> T LOC_Os05g49550.1 upstream_gene_variant ; 2998.0bp to feature; MODIFIER silent_mutation Average:40.87; most accessible tissue: Zhenshan97 root, score: 64.045 N N N N
vg0528415027 C -> T LOC_Os05g49540.1 intron_variant ; MODIFIER silent_mutation Average:40.87; most accessible tissue: Zhenshan97 root, score: 64.045 N N N N
vg0528415027 C -> DEL N N silent_mutation Average:40.87; most accessible tissue: Zhenshan97 root, score: 64.045 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528415027 NA 1.77E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 4.23E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 2.36E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 2.90E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 7.07E-14 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 4.20E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 5.23E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 1.26E-09 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 2.99E-08 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 1.94E-14 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 7.58E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 2.48E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 4.89E-09 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 1.53E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 1.31E-12 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 1.88E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 8.63E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 1.76E-09 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 2.02E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 4.75E-07 NA mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 3.91E-06 3.99E-08 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 8.57E-14 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528415027 NA 5.70E-06 mr1866_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251