\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527924557:

Variant ID: vg0527924557 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27924557
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGGGGAATTTGGAGGTTGATTCACGAGGCGAATATCAAGACCCATTTGACCTACTGCAACACCAAATTGTTCATCATCGATTGGGACATGCGTTCTAG[C/A]
ATTATCCTGCTGAATAAATATTGTTCTTCTTGCATCTTCTTGGGGCCAACATGCTCTAATAGCTGGGAGAACTTTAGAGATCATGAATGATTTCATAGTG

Reverse complement sequence

CACTATGAAATCATTCATGATCTCTAAAGTTCTCCCAGCTATTAGAGCATGTTGGCCCCAAGAAGATGCAAGAAGAACAATATTTATTCAGCAGGATAAT[G/T]
CTAGAACGCATGTCCCAATCGATGATGAACAATTTGGTGTTGCAGTAGGTCAAATGGGTCTTGATATTCGCCTCGTGAATCAACCTCCAAATTCCCCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 3.20% 15.36% 52.31% NA
All Indica  2759 10.00% 4.50% 21.82% 63.72% NA
All Japonica  1512 64.50% 1.00% 6.08% 28.44% NA
Aus  269 4.10% 3.30% 5.95% 86.62% NA
Indica I  595 4.70% 2.00% 21.51% 71.76% NA
Indica II  465 26.70% 3.20% 12.90% 57.20% NA
Indica III  913 5.10% 7.20% 23.44% 64.18% NA
Indica Intermediate  786 9.70% 3.90% 25.45% 60.94% NA
Temperate Japonica  767 97.50% 0.00% 0.39% 2.09% NA
Tropical Japonica  504 14.50% 2.60% 13.10% 69.84% NA
Japonica Intermediate  241 63.90% 0.80% 9.54% 25.73% NA
VI/Aromatic  96 87.50% 0.00% 4.17% 8.33% NA
Intermediate  90 36.70% 2.20% 13.33% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527924557 C -> DEL LOC_Os05g48720.1 N frameshift_variant Average:9.336; most accessible tissue: Callus, score: 34.561 N N N N
vg0527924557 C -> A LOC_Os05g48720.1 missense_variant ; p.Ala357Ser; MODERATE nonsynonymous_codon ; A357S Average:9.336; most accessible tissue: Callus, score: 34.561 benign 1.41 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527924557 NA 1.77E-22 mr1156_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 7.04E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.60E-08 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 2.86E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.91E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 2.13E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 2.47E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 4.08E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 4.84E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 5.37E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 4.06E-11 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 2.11E-06 NA mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 2.75E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.11E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 8.81E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.37E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.82E-07 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 2.09E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 3.04E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 7.62E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.29E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.32E-07 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.53E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.14E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 2.06E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 7.86E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 8.61E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 2.02E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557 NA 1.74E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251