Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527924557:

Variant ID: vg0527924557 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27924557
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGGGGAATTTGGAGGTTGATTCACGAGGCGAATATCAAGACCCATTTGACCTACTGCAACACCAAATTGTTCATCATCGATTGGGACATGCGTTCTAG[C/A]
ATTATCCTGCTGAATAAATATTGTTCTTCTTGCATCTTCTTGGGGCCAACATGCTCTAATAGCTGGGAGAACTTTAGAGATCATGAATGATTTCATAGTG

Reverse complement sequence

CACTATGAAATCATTCATGATCTCTAAAGTTCTCCCAGCTATTAGAGCATGTTGGCCCCAAGAAGATGCAAGAAGAACAATATTTATTCAGCAGGATAAT[G/T]
CTAGAACGCATGTCCCAATCGATGATGAACAATTTGGTGTTGCAGTAGGTCAAATGGGTCTTGATATTCGCCTCGTGAATCAACCTCCAAATTCCCCCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.20%	3.20%	15.36%	52.31%	NA
All Indica	2759	10.00%	4.50%	21.82%	63.72%	NA
All Japonica	1512	64.50%	1.00%	6.08%	28.44%	NA
Aus	269	4.10%	3.30%	5.95%	86.62%	NA
Indica I	595	4.70%	2.00%	21.51%	71.76%	NA
Indica II	465	26.70%	3.20%	12.90%	57.20%	NA
Indica III	913	5.10%	7.20%	23.44%	64.18%	NA
Indica Intermediate	786	9.70%	3.90%	25.45%	60.94%	NA
Temperate Japonica	767	97.50%	0.00%	0.39%	2.09%	NA
Tropical Japonica	504	14.50%	2.60%	13.10%	69.84%	NA
Japonica Intermediate	241	63.90%	0.80%	9.54%	25.73%	NA
VI/Aromatic	96	87.50%	0.00%	4.17%	8.33%	NA
Intermediate	90	36.70%	2.20%	13.33%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527924557	C -> DEL	LOC_Os05g48720.1	N	frameshift_variant	Average:9.336; most accessible tissue: Callus, score: 34.561	N	N	N	N
vg0527924557	C -> A	LOC_Os05g48720.1	missense_variant ; p.Ala357Ser; MODERATE	nonsynonymous_codon ; A357S	Average:9.336; most accessible tissue: Callus, score: 34.561	benign	1.41	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527924557	NA	1.77E-22	mr1156_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	7.04E-09	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.60E-08	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	2.86E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.91E-07	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	2.13E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	2.47E-09	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	4.08E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	4.84E-11	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	5.37E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	4.06E-11	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	2.11E-06	NA	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	2.75E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.11E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	8.81E-07	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.37E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.82E-07	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	2.09E-10	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	3.04E-06	mr1747_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	7.62E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.29E-10	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.32E-07	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.53E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.14E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	2.06E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	7.86E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	8.61E-07	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	2.02E-14	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527924557	NA	1.74E-08	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251