\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527368751:

Variant ID: vg0527368751 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27368751
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTGCTCCACAGCTCCACTCCACCTTAAAGACCCACTACCCTTTAATTTTTTAGTCTATTTACACAAAAATGCCATTGAGCTACCCTTCCTATCTTCT[T/C]
TCCTCCCGTTCTCTCTCCTCCCCCATCCTCCTCCCGAGGCCGGCCATGGAAGGTTTCATTTGCGTCGTTGGCAGCGAGCGGCGGCTGAGTCACGTCGGCG

Reverse complement sequence

CGCCGACGTGACTCAGCCGCCGCTCGCTGCCAACGACGCAAATGAAACCTTCCATGGCCGGCCTCGGGAGGAGGATGGGGGAGGAGAGAGAACGGGAGGA[A/G]
AGAAGATAGGAAGGGTAGCTCAATGGCATTTTTGTGTAAATAGACTAAAAAATTAAAGGGTAGTGGGTCTTTAAGGTGGAGTGGAGCTGTGGAGCAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.30% 0.49% 0.00% NA
All Indica  2759 78.70% 20.70% 0.58% 0.00% NA
All Japonica  1512 80.00% 19.80% 0.20% 0.00% NA
Aus  269 19.00% 81.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 60.60% 38.90% 0.43% 0.00% NA
Indica III  913 76.10% 23.20% 0.66% 0.00% NA
Indica Intermediate  786 77.20% 21.90% 0.89% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 56.50% 43.10% 0.40% 0.00% NA
Japonica Intermediate  241 68.50% 31.10% 0.41% 0.00% NA
VI/Aromatic  96 66.70% 32.30% 1.04% 0.00% NA
Intermediate  90 63.30% 33.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527368751 T -> C LOC_Os05g47770.1 downstream_gene_variant ; 1206.0bp to feature; MODIFIER silent_mutation Average:76.021; most accessible tissue: Callus, score: 90.616 N N N N
vg0527368751 T -> C LOC_Os05g47770-LOC_Os05g47780 intergenic_region ; MODIFIER silent_mutation Average:76.021; most accessible tissue: Callus, score: 90.616 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527368751 NA 2.45E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 5.31E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 2.69E-12 mr1178 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 3.22E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 3.17E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 4.49E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 9.72E-12 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 2.74E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 1.16E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 7.31E-07 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 1.29E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 5.40E-08 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 3.53E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751 NA 5.96E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251