\
| Variant ID: vg0526986295 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26986295 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 108. )
AAAATTCTGAAGTTTAAATTAAGCCTACACATTCAGATAAAAAAAATCTACAGATTGTTACATGAACTATTTACTACGGTATTTGCCTTCTCTGCCTCTT[A/T]
CTTTGTAGATAGAGTTTAGATTTATTTTTATCAGATGCCAGTATACTCCGTATTTATATATTTTTTAAAATATATAACTATTTTGTTTCTAAAAAAAACT
AGTTTTTTTTAGAAACAAAATAGTTATATATTTTAAAAAATATATAAATACGGAGTATACTGGCATCTGATAAAAATAAATCTAAACTCTATCTACAAAG[T/A]
AAGAGGCAGAGAAGGCAAATACCGTAGTAAATAGTTCATGTAACAATCTGTAGATTTTTTTTATCTGAATGTGTAGGCTTAATTTAAACTTCAGAATTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.60% | 45.00% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 38.00% | 61.30% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 74.30% | 25.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 39.50% | 59.20% | 1.34% | 0.00% | NA |
| Indica II | 465 | 48.40% | 51.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 29.10% | 70.30% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 41.10% | 58.10% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 38.70% | 61.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526986295 | A -> T | LOC_Os05g46610.1 | upstream_gene_variant ; 1039.0bp to feature; MODIFIER | silent_mutation | Average:46.19; most accessible tissue: Minghui63 root, score: 57.225 | N | N | N | N |
| vg0526986295 | A -> T | LOC_Os05g46620.1 | downstream_gene_variant ; 4947.0bp to feature; MODIFIER | silent_mutation | Average:46.19; most accessible tissue: Minghui63 root, score: 57.225 | N | N | N | N |
| vg0526986295 | A -> T | LOC_Os05g46600-LOC_Os05g46610 | intergenic_region ; MODIFIER | silent_mutation | Average:46.19; most accessible tissue: Minghui63 root, score: 57.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526986295 | NA | 2.94E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0526986295 | NA | 2.06E-06 | mr1020 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 9.34E-07 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 2.01E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 9.61E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 6.89E-07 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 5.56E-08 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | 3.60E-07 | 1.27E-13 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 7.67E-06 | mr1448 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 5.07E-08 | mr1477 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 2.06E-07 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | 7.01E-06 | 9.84E-06 | mr1642 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 1.14E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 6.57E-06 | mr1786 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 1.80E-08 | mr1971 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 3.66E-06 | mr1165_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 5.54E-07 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 1.37E-07 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 8.81E-06 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 1.34E-08 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 1.44E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 2.21E-07 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 3.19E-07 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 1.59E-08 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 9.23E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 5.02E-09 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 9.25E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 8.18E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526986295 | NA | 6.57E-08 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |