\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526975862:

Variant ID: vg0526975862 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26975862
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATGCTGATTATAGGAAATTGTAAATGTTTCTATATATTTTATTATATATGTGCATAGTTCGTAGTAAAGATTATGCATCAAAATGATGTATCGTACA[G/A]
TCAATGCGTCAATCGGTATCGATATATCTGCTATTTTAGAATTCCGAATACCCATCACATAAATCCTAGATCCGCCACTGGCTCCTACCAGGACAAGGAT

Reverse complement sequence

ATCCTTGTCCTGGTAGGAGCCAGTGGCGGATCTAGGATTTATGTGATGGGTATTCGGAATTCTAAAATAGCAGATATATCGATACCGATTGACGCATTGA[C/T]
TGTACGATACATCATTTTGATGCATAATCTTTACTACGAACTATGCACATATATAATAAAATATATAGAAACATTTACAATTTCCTATAATCAGCATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 8.50% 0.17% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 75.50% 24.10% 0.33% 0.00% NA
Aus  269 93.70% 5.60% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 96.70% 3.30% 0.00% 0.00% NA
Tropical Japonica  504 40.90% 58.10% 0.99% 0.00% NA
Japonica Intermediate  241 80.50% 19.50% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526975862 G -> A LOC_Os05g46590.1 downstream_gene_variant ; 2892.0bp to feature; MODIFIER silent_mutation Average:54.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg0526975862 G -> A LOC_Os05g46600.1 downstream_gene_variant ; 1363.0bp to feature; MODIFIER silent_mutation Average:54.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg0526975862 G -> A LOC_Os05g46600-LOC_Os05g46610 intergenic_region ; MODIFIER silent_mutation Average:54.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526975862 NA 3.49E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 3.21E-10 NA mr1194 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 1.20E-08 3.72E-17 mr1194 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 1.61E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 5.99E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 1.94E-06 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 5.34E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 9.68E-06 mr1887 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 1.34E-08 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 3.34E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 4.24E-07 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975862 NA 3.27E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251