\
| Variant ID: vg0526975862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26975862 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )
TTGATGCTGATTATAGGAAATTGTAAATGTTTCTATATATTTTATTATATATGTGCATAGTTCGTAGTAAAGATTATGCATCAAAATGATGTATCGTACA[G/A]
TCAATGCGTCAATCGGTATCGATATATCTGCTATTTTAGAATTCCGAATACCCATCACATAAATCCTAGATCCGCCACTGGCTCCTACCAGGACAAGGAT
ATCCTTGTCCTGGTAGGAGCCAGTGGCGGATCTAGGATTTATGTGATGGGTATTCGGAATTCTAAAATAGCAGATATATCGATACCGATTGACGCATTGA[C/T]
TGTACGATACATCATTTTGATGCATAATCTTTACTACGAACTATGCACATATATAATAAAATATATAGAAACATTTACAATTTCCTATAATCAGCATCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 8.50% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 75.50% | 24.10% | 0.33% | 0.00% | NA |
| Aus | 269 | 93.70% | 5.60% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 40.90% | 58.10% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.50% | 19.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526975862 | G -> A | LOC_Os05g46590.1 | downstream_gene_variant ; 2892.0bp to feature; MODIFIER | silent_mutation | Average:54.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0526975862 | G -> A | LOC_Os05g46600.1 | downstream_gene_variant ; 1363.0bp to feature; MODIFIER | silent_mutation | Average:54.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0526975862 | G -> A | LOC_Os05g46600-LOC_Os05g46610 | intergenic_region ; MODIFIER | silent_mutation | Average:54.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526975862 | NA | 3.49E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | 3.21E-10 | NA | mr1194 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | 1.20E-08 | 3.72E-17 | mr1194 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 1.61E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 5.99E-06 | mr1272 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 1.94E-06 | mr1482 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 5.34E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 9.68E-06 | mr1887 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 1.34E-08 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 3.34E-17 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 4.24E-07 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526975862 | NA | 3.27E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |