\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526404054:

Variant ID: vg0526404054 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26404054
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCAAACGGCCAGGAGATGCGACCTCGCCTCGATGGCCTGCCAAGAAACAGGAAGCAGCATGCACGCGGTCATCTACACCAGCACGCCGGCGTACAACA[T/G,A]
CGTCCCTTAATTTTCTTTTGCAGATCGATCACGGATTCACGGAGGAGGAAACCATCGGCGCCTTGCTCTGGCAGCCTGTAGACCACTCATCAACATTAGC

Reverse complement sequence

GCTAATGTTGATGAGTGGTCTACAGGCTGCCAGAGCAAGGCGCCGATGGTTTCCTCCTCCGTGAATCCGTGATCGATCTGCAAAAGAAAATTAAGGGACG[A/C,T]
TGTTGTACGCCGGCGTGCTGGTGTAGATGACCGCGTGCATGCTGCTTCCTGTTTCTTGGCAGGCCATCGAGGCGAGGTCGCATCTCCTGGCCGTTTGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 24.10% 3.03% 2.62% A: 0.23%
All Indica  2759 91.70% 6.30% 1.49% 0.07% A: 0.40%
All Japonica  1512 25.10% 60.80% 6.02% 8.07% NA
Aus  269 97.00% 1.10% 1.86% 0.00% NA
Indica I  595 98.80% 0.20% 0.84% 0.00% A: 0.17%
Indica II  465 70.80% 27.70% 1.51% 0.00% NA
Indica III  913 97.30% 0.10% 2.41% 0.11% A: 0.11%
Indica Intermediate  786 92.20% 5.60% 0.89% 0.13% A: 1.15%
Temperate Japonica  767 25.30% 64.30% 8.08% 2.35% NA
Tropical Japonica  504 24.40% 63.70% 3.37% 8.53% NA
Japonica Intermediate  241 25.70% 44.00% 4.98% 25.31% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 54.40% 38.90% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526404054 T -> DEL N N silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0526404054 T -> G LOC_Os05g45550.1 upstream_gene_variant ; 871.0bp to feature; MODIFIER silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0526404054 T -> G LOC_Os05g45560.1 upstream_gene_variant ; 2218.0bp to feature; MODIFIER silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0526404054 T -> G LOC_Os05g45570.1 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0526404054 T -> G LOC_Os05g45550-LOC_Os05g45560 intergenic_region ; MODIFIER silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0526404054 T -> A LOC_Os05g45550.1 upstream_gene_variant ; 871.0bp to feature; MODIFIER silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0526404054 T -> A LOC_Os05g45560.1 upstream_gene_variant ; 2218.0bp to feature; MODIFIER silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0526404054 T -> A LOC_Os05g45570.1 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0526404054 T -> A LOC_Os05g45550-LOC_Os05g45560 intergenic_region ; MODIFIER silent_mutation Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526404054 NA 7.94E-14 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 6.06E-15 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.37E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 9.94E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.42E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 4.44E-14 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 3.60E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 5.19E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 8.65E-15 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 8.88E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 7.17E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 4.77E-13 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 7.70E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 2.06E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.36E-13 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 9.41E-12 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 8.13E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 3.39E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 2.98E-13 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.58E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 2.87E-12 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.70E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.19E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 1.89E-06 1.96E-09 mr1173_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 4.71E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 2.68E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.48E-18 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.06E-10 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 5.35E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 2.24E-15 mr1301_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 5.37E-10 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.43E-09 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 2.92E-13 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 6.23E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 6.05E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 1.19E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 4.47E-12 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 2.67E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 3.41E-06 mr1645_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 4.79E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 7.67E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 3.38E-07 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 8.35E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 3.58E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054 NA 3.99E-09 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251