Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526404054:

Variant ID: vg0526404054 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26404054
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCAAACGGCCAGGAGATGCGACCTCGCCTCGATGGCCTGCCAAGAAACAGGAAGCAGCATGCACGCGGTCATCTACACCAGCACGCCGGCGTACAACA[T/G,A]
CGTCCCTTAATTTTCTTTTGCAGATCGATCACGGATTCACGGAGGAGGAAACCATCGGCGCCTTGCTCTGGCAGCCTGTAGACCACTCATCAACATTAGC

Reverse complement sequence

GCTAATGTTGATGAGTGGTCTACAGGCTGCCAGAGCAAGGCGCCGATGGTTTCCTCCTCCGTGAATCCGTGATCGATCTGCAAAAGAAAATTAAGGGACG[A/C,T]
TGTTGTACGCCGGCGTGCTGGTGTAGATGACCGCGTGCATGCTGCTTCCTGTTTCTTGGCAGGCCATCGAGGCGAGGTCGCATCTCCTGGCCGTTTGCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	24.10%	3.03%	2.62%	A: 0.23%
All Indica	2759	91.70%	6.30%	1.49%	0.07%	A: 0.40%
All Japonica	1512	25.10%	60.80%	6.02%	8.07%	NA
Aus	269	97.00%	1.10%	1.86%	0.00%	NA
Indica I	595	98.80%	0.20%	0.84%	0.00%	A: 0.17%
Indica II	465	70.80%	27.70%	1.51%	0.00%	NA
Indica III	913	97.30%	0.10%	2.41%	0.11%	A: 0.11%
Indica Intermediate	786	92.20%	5.60%	0.89%	0.13%	A: 1.15%
Temperate Japonica	767	25.30%	64.30%	8.08%	2.35%	NA
Tropical Japonica	504	24.40%	63.70%	3.37%	8.53%	NA
Japonica Intermediate	241	25.70%	44.00%	4.98%	25.31%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	54.40%	38.90%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0526404054	T -> DEL	N	N	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0526404054	T -> G	LOC_Os05g45550.1	upstream_gene_variant ; 871.0bp to feature; MODIFIER	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0526404054	T -> G	LOC_Os05g45560.1	upstream_gene_variant ; 2218.0bp to feature; MODIFIER	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0526404054	T -> G	LOC_Os05g45570.1	downstream_gene_variant ; 3748.0bp to feature; MODIFIER	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0526404054	T -> G	LOC_Os05g45550-LOC_Os05g45560	intergenic_region ; MODIFIER	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0526404054	T -> A	LOC_Os05g45550.1	upstream_gene_variant ; 871.0bp to feature; MODIFIER	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0526404054	T -> A	LOC_Os05g45560.1	upstream_gene_variant ; 2218.0bp to feature; MODIFIER	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0526404054	T -> A	LOC_Os05g45570.1	downstream_gene_variant ; 3748.0bp to feature; MODIFIER	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0526404054	T -> A	LOC_Os05g45550-LOC_Os05g45560	intergenic_region ; MODIFIER	silent_mutation	Average:74.982; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0526404054	NA	7.94E-14	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	6.06E-15	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.37E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	9.94E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.42E-11	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	4.44E-14	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	3.60E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	5.19E-12	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	8.65E-15	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	8.88E-10	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	7.17E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	4.77E-13	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	7.70E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	2.06E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.36E-13	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	9.41E-12	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	8.13E-10	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	3.39E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	2.98E-13	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.58E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	2.87E-12	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.70E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.19E-12	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	1.89E-06	1.96E-09	mr1173_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	4.71E-13	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	2.68E-06	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.48E-18	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.06E-10	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	5.35E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	2.24E-15	mr1301_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	5.37E-10	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.43E-09	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	2.92E-13	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	6.23E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	6.05E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	1.19E-12	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	4.47E-12	mr1546_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	2.67E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	3.41E-06	mr1645_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	4.79E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	7.67E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	3.38E-07	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	8.35E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	3.58E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526404054	NA	3.99E-09	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251