\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526371956:

Variant ID: vg0526371956 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26371956
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.44, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CAACCTCAGCGGCTACAACCGCTACATGGACGCGTCTCCCCTACCAAGTTAGTATCCAGTGCCGTAGGCAAATGTCGGAGATGTAAACCATTTTCATTAC[A/G]
TATGTAGAAATTAATTAATCTTCACTTTGGAGATATATATAGTAATTTAAGTTTTGTTTGTTATTTTTGTTACAATTTATTAAAGTTAAATTTTAACTTG

Reverse complement sequence

CAAGTTAAAATTTAACTTTAATAAATTGTAACAAAAATAACAAACAAAACTTAAATTACTATATATATCTCCAAAGTGAAGATTAATTAATTTCTACATA[T/C]
GTAATGAAAATGGTTTACATCTCCGACATTTGCCTACGGCACTGGATACTAACTTGGTAGGGGAGACGCGTCCATGTAGCGGTTGTAGCCGCTGAGGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.20% 0.28% 0.11% NA
All Indica  2759 92.80% 6.80% 0.25% 0.18% NA
All Japonica  1512 9.70% 90.10% 0.20% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.17% 0.17% NA
Indica II  465 69.90% 28.80% 0.65% 0.65% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.20% 0.38% 0.13% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 9.90% 89.70% 0.40% 0.00% NA
Japonica Intermediate  241 27.80% 71.80% 0.41% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 48.90% 47.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526371956 A -> DEL N N silent_mutation Average:69.88; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0526371956 A -> G LOC_Os05g45470.1 upstream_gene_variant ; 2658.0bp to feature; MODIFIER silent_mutation Average:69.88; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0526371956 A -> G LOC_Os05g45440.1 downstream_gene_variant ; 4868.0bp to feature; MODIFIER silent_mutation Average:69.88; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0526371956 A -> G LOC_Os05g45450.1 downstream_gene_variant ; 2937.0bp to feature; MODIFIER silent_mutation Average:69.88; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0526371956 A -> G LOC_Os05g45460.1 intron_variant ; MODIFIER silent_mutation Average:69.88; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526371956 NA 6.12E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 4.83E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 2.79E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.44E-08 mr1044 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.57E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.17E-11 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.42E-10 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 3.04E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.07E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.29E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 7.26E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 4.85E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 2.65E-28 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 4.99E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 2.40E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 6.43E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.12E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.46E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.29E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 4.64E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 5.98E-21 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 2.22E-10 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.46E-09 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.94E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 8.90E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.30E-48 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 3.55E-12 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 3.36E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.75E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 5.99E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 1.17E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 4.87E-07 2.83E-70 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 1.66E-06 2.97E-12 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 6.13E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526371956 NA 3.44E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251