\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526329290:

Variant ID: vg0526329290 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26329290
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTAGATCGAATTAGAGCATAAAATGATCCTTTTTCAAATGAAGATGGATCTATTCGTTCAAAAAAATGAAGATGGATCGGGCACAATCTGTGGATGAA[C/T]
TGGCTGGAAATAATATGCAGTTTGTGCACTGCGCAATGCAACCGTAGTGCACTCACTTCATCGCCAAAATAAAAAGGAAAAACACCGGGGTTCAGGTTCA

Reverse complement sequence

TGAACCTGAACCCCGGTGTTTTTCCTTTTTATTTTGGCGATGAAGTGAGTGCACTACGGTTGCATTGCGCAGTGCACAAACTGCATATTATTTCCAGCCA[G/A]
TTCATCCACAGATTGTGCCCGATCCATCTTCATTTTTTTGAACGAATAGATCCATCTTCATTTGAAAAAGGATCATTTTATGCTCTAATTCGATCTAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 3.30% 2.37% 0.00% NA
All Indica  2759 90.30% 5.70% 4.02% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 67.40% 18.70% 13.95% 0.00% NA
Indica II  465 98.90% 0.00% 1.08% 0.00% NA
Indica III  913 97.80% 2.10% 0.11% 0.00% NA
Indica Intermediate  786 93.60% 3.60% 2.80% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526329290 C -> T LOC_Os05g45370.1 upstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0526329290 C -> T LOC_Os05g45380.1 downstream_gene_variant ; 366.0bp to feature; MODIFIER silent_mutation Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0526329290 C -> T LOC_Os05g45390.1 downstream_gene_variant ; 1677.0bp to feature; MODIFIER silent_mutation Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0526329290 C -> T LOC_Os05g45400.1 downstream_gene_variant ; 4503.0bp to feature; MODIFIER silent_mutation Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0526329290 C -> T LOC_Os05g45380-LOC_Os05g45390 intergenic_region ; MODIFIER silent_mutation Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526329290 NA 2.91E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 1.03E-07 6.74E-14 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 1.33E-06 3.30E-13 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 7.17E-08 6.65E-16 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 2.64E-06 9.35E-14 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 NA 7.73E-07 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 3.55E-07 4.64E-14 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 7.00E-06 3.47E-12 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 2.64E-08 9.79E-15 mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290 1.65E-06 1.79E-13 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251