| Variant ID: vg0526329290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26329290 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 304. )
CTTTAGATCGAATTAGAGCATAAAATGATCCTTTTTCAAATGAAGATGGATCTATTCGTTCAAAAAAATGAAGATGGATCGGGCACAATCTGTGGATGAA[C/T]
TGGCTGGAAATAATATGCAGTTTGTGCACTGCGCAATGCAACCGTAGTGCACTCACTTCATCGCCAAAATAAAAAGGAAAAACACCGGGGTTCAGGTTCA
TGAACCTGAACCCCGGTGTTTTTCCTTTTTATTTTGGCGATGAAGTGAGTGCACTACGGTTGCATTGCGCAGTGCACAAACTGCATATTATTTCCAGCCA[G/A]
TTCATCCACAGATTGTGCCCGATCCATCTTCATTTTTTTGAACGAATAGATCCATCTTCATTTGAAAAAGGATCATTTTATGCTCTAATTCGATCTAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.30% | 3.30% | 2.37% | 0.00% | NA |
| All Indica | 2759 | 90.30% | 5.70% | 4.02% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.40% | 18.70% | 13.95% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 3.60% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526329290 | C -> T | LOC_Os05g45370.1 | upstream_gene_variant ; 3138.0bp to feature; MODIFIER | silent_mutation | Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0526329290 | C -> T | LOC_Os05g45380.1 | downstream_gene_variant ; 366.0bp to feature; MODIFIER | silent_mutation | Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0526329290 | C -> T | LOC_Os05g45390.1 | downstream_gene_variant ; 1677.0bp to feature; MODIFIER | silent_mutation | Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0526329290 | C -> T | LOC_Os05g45400.1 | downstream_gene_variant ; 4503.0bp to feature; MODIFIER | silent_mutation | Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| vg0526329290 | C -> T | LOC_Os05g45380-LOC_Os05g45390 | intergenic_region ; MODIFIER | silent_mutation | Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526329290 | NA | 2.91E-06 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | 1.03E-07 | 6.74E-14 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | 1.33E-06 | 3.30E-13 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | 7.17E-08 | 6.65E-16 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | 2.64E-06 | 9.35E-14 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | NA | 7.73E-07 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | 3.55E-07 | 4.64E-14 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | 7.00E-06 | 3.47E-12 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | 2.64E-08 | 9.79E-15 | mr1389_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526329290 | 1.65E-06 | 1.79E-13 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |