Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0526329290:

Variant ID: vg0526329290 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26329290
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTAGATCGAATTAGAGCATAAAATGATCCTTTTTCAAATGAAGATGGATCTATTCGTTCAAAAAAATGAAGATGGATCGGGCACAATCTGTGGATGAA[C/T]
TGGCTGGAAATAATATGCAGTTTGTGCACTGCGCAATGCAACCGTAGTGCACTCACTTCATCGCCAAAATAAAAAGGAAAAACACCGGGGTTCAGGTTCA

Reverse complement sequence

TGAACCTGAACCCCGGTGTTTTTCCTTTTTATTTTGGCGATGAAGTGAGTGCACTACGGTTGCATTGCGCAGTGCACAAACTGCATATTATTTCCAGCCA[G/A]
TTCATCCACAGATTGTGCCCGATCCATCTTCATTTTTTTGAACGAATAGATCCATCTTCATTTGAAAAAGGATCATTTTATGCTCTAATTCGATCTAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.30%	3.30%	2.37%	0.00%	NA
All Indica	2759	90.30%	5.70%	4.02%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	67.40%	18.70%	13.95%	0.00%	NA
Indica II	465	98.90%	0.00%	1.08%	0.00%	NA
Indica III	913	97.80%	2.10%	0.11%	0.00%	NA
Indica Intermediate	786	93.60%	3.60%	2.80%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0526329290	C -> T	LOC_Os05g45370.1	upstream_gene_variant ; 3138.0bp to feature; MODIFIER	silent_mutation	Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0526329290	C -> T	LOC_Os05g45380.1	downstream_gene_variant ; 366.0bp to feature; MODIFIER	silent_mutation	Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0526329290	C -> T	LOC_Os05g45390.1	downstream_gene_variant ; 1677.0bp to feature; MODIFIER	silent_mutation	Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0526329290	C -> T	LOC_Os05g45400.1	downstream_gene_variant ; 4503.0bp to feature; MODIFIER	silent_mutation	Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg0526329290	C -> T	LOC_Os05g45380-LOC_Os05g45390	intergenic_region ; MODIFIER	silent_mutation	Average:66.929; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0526329290	NA	2.91E-06	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	1.03E-07	6.74E-14	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	1.33E-06	3.30E-13	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	7.17E-08	6.65E-16	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	2.64E-06	9.35E-14	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	NA	7.73E-07	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	3.55E-07	4.64E-14	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	7.00E-06	3.47E-12	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	2.64E-08	9.79E-15	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526329290	1.65E-06	1.79E-13	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251