\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524744488:

Variant ID: vg0524744488 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24744488
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGCGCCCCAGCCCTCGGGGCCAAGGCAGGAGCGGTCTGACCCCCTCGGGGAGACAAAGAGGAGGGCGAACACACCACCCTCGGGCCCGACGCCCCCCC[C/G]
GAGGGTGCCAGGCCACGTGGGCGATTGTGTCTGCCTCAAGCCTCTAGTCACGATACTCCCGGTCCCATGTCATCGACAGTAGCCCCCGGCGTTATGCCGG

Reverse complement sequence

CCGGCATAACGCCGGGGGCTACTGTCGATGACATGGGACCGGGAGTATCGTGACTAGAGGCTTGAGGCAGACACAATCGCCCACGTGGCCTGGCACCCTC[G/C]
GGGGGGGCGTCGGGCCCGAGGGTGGTGTGTTCGCCCTCCTCTTTGTCTCCCCGAGGGGGTCAGACCGCTCCTGCCTTGGCCCCGAGGGCTGGGGCGCCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 0.20% 0.95% 51.97% NA
All Indica  2759 19.00% 0.30% 1.41% 79.27% NA
All Japonica  1512 99.50% 0.00% 0.13% 0.40% NA
Aus  269 14.10% 0.00% 1.49% 84.39% NA
Indica I  595 13.10% 0.50% 2.18% 84.20% NA
Indica II  465 41.70% 0.40% 0.43% 57.42% NA
Indica III  913 12.20% 0.10% 1.42% 86.31% NA
Indica Intermediate  786 18.10% 0.30% 1.40% 80.28% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 98.60% 0.00% 0.40% 0.99% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 63.30% 1.10% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524744488 C -> DEL N N silent_mutation Average:7.626; most accessible tissue: Callus, score: 21.898 N N N N
vg0524744488 C -> G LOC_Os05g42300.1 upstream_gene_variant ; 1937.0bp to feature; MODIFIER silent_mutation Average:7.626; most accessible tissue: Callus, score: 21.898 N N N N
vg0524744488 C -> G LOC_Os05g42310.1 upstream_gene_variant ; 660.0bp to feature; MODIFIER silent_mutation Average:7.626; most accessible tissue: Callus, score: 21.898 N N N N
vg0524744488 C -> G LOC_Os05g42320.1 downstream_gene_variant ; 4579.0bp to feature; MODIFIER silent_mutation Average:7.626; most accessible tissue: Callus, score: 21.898 N N N N
vg0524744488 C -> G LOC_Os05g42300-LOC_Os05g42310 intergenic_region ; MODIFIER silent_mutation Average:7.626; most accessible tissue: Callus, score: 21.898 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524744488 NA 9.79E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 1.24E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 1.28E-13 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 6.42E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 5.44E-11 3.28E-71 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 4.72E-10 1.17E-24 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 3.62E-10 2.55E-88 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 2.57E-09 8.37E-24 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 6.58E-13 3.89E-47 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 6.30E-13 6.00E-28 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 1.93E-12 1.08E-105 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 8.34E-10 1.88E-34 mr1907 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 4.61E-09 4.83E-97 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 3.59E-11 5.42E-30 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 2.43E-10 6.07E-77 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 4.06E-09 9.41E-24 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 1.61E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 4.39E-16 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 3.16E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 4.90E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 3.28E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 7.21E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 2.61E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 5.56E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 3.82E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 1.43E-11 6.45E-82 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 1.05E-11 3.33E-28 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 4.39E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 6.79E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 1.93E-12 1.07E-81 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 2.86E-13 1.01E-26 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 2.45E-12 3.06E-109 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 1.26E-13 5.67E-35 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 NA 5.36E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 4.57E-09 1.17E-96 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524744488 9.17E-13 9.28E-31 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251