\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523999762:

Variant ID: vg0523999762 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23999762
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CTATGAAGTGTCATTCTTATGGCCGTGTTTAGTTACATCCCAAATGCCCCTAACTTTTCATCACATCACATCACATCCAAAACTTTTCTACACACGTAAA[C/T]
TTTTAACTTTTTTTTCAAACGAACTAGACACACCTTATTCCGCGTGACCGTTATAATAAACCAGCATACATTGAGTGAGGAACTTTGACAAAAAAGAACA

Reverse complement sequence

TGTTCTTTTTTGTCAAAGTTCCTCACTCAATGTATGCTGGTTTATTATAACGGTCACGCGGAATAAGGTGTGTCTAGTTCGTTTGAAAAAAAAGTTAAAA[G/A]
TTTACGTGTGTAGAAAAGTTTTGGATGTGATGTGATGTGATGAAAAGTTAGGGGCATTTGGGATGTAACTAAACACGGCCATAAGAATGACACTTCATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.00% 0.78% 0.00% NA
All Indica  2759 94.40% 5.50% 0.07% 0.00% NA
All Japonica  1512 56.20% 41.70% 2.12% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.50% 9.20% 0.22% 0.00% NA
Indica III  913 91.30% 8.50% 0.11% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 73.00% 23.60% 3.39% 0.00% NA
Tropical Japonica  504 26.00% 73.60% 0.40% 0.00% NA
Japonica Intermediate  241 66.00% 32.40% 1.66% 0.00% NA
VI/Aromatic  96 39.60% 58.30% 2.08% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523999762 C -> T LOC_Os05g40910.1 downstream_gene_variant ; 2146.0bp to feature; MODIFIER silent_mutation Average:59.682; most accessible tissue: Callus, score: 89.152 N N N N
vg0523999762 C -> T LOC_Os05g40920.1 downstream_gene_variant ; 505.0bp to feature; MODIFIER silent_mutation Average:59.682; most accessible tissue: Callus, score: 89.152 N N N N
vg0523999762 C -> T LOC_Os05g40910-LOC_Os05g40920 intergenic_region ; MODIFIER silent_mutation Average:59.682; most accessible tissue: Callus, score: 89.152 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523999762 NA 7.62E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 4.07E-06 NA mr1194 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 2.02E-09 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 1.48E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 6.54E-06 mr1492 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 4.08E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 9.02E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 4.87E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 6.55E-07 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 3.03E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 3.52E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 3.52E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 1.65E-06 mr1802 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 1.46E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 8.72E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 1.34E-10 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 9.54E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 1.24E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 1.53E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 1.11E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 1.15E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 3.45E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 3.62E-08 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523999762 NA 3.65E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251