\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523549315:

Variant ID: vg0523549315 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 23549315
Reference Allele: ATAlternative Allele: A,TT,ATT
Primary Allele: ASecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGTTGGGCTTAATTATCAAATTAGTTGGCCCAACAACCATGCATGCATAGACTTGTGTACTTCCTTATCACCTAGACTTTGCCATATATAGATTTGAT[AT/A,TT,ATT]
TTTTTTTACTAAATTCCAAACTGAACTTTCAAGTTAACTTTTAATATTTTCAAAAATCAGAATATAGAAGTGCAAATTTACATTTTCAAAATTGGATGGG

Reverse complement sequence

CCCATCCAATTTTGAAAATGTAAATTTGCACTTCTATATTCTGATTTTTGAAAATATTAAAAGTTAACTTGAAAGTTCAGTTTGGAATTTAGTAAAAAAA[AT/T,AA,AAT]
ATCAAATCTATATATGGCAAAGTCTAGGTGATAAGGAAGTACACAAGTCTATGCATGCATGGTTGTTGGGCCAACTAATTTGATAATTAAGCCCAACCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 44.50% 0.49% 0.00% TT: 4.17%; ATT: 0.04%
All Indica  2759 82.00% 17.30% 0.33% 0.00% TT: 0.36%
All Japonica  1512 0.40% 99.30% 0.20% 0.00% ATT: 0.07%
Aus  269 33.50% 4.50% 1.86% 0.00% TT: 60.22%
Indica I  595 87.40% 12.30% 0.34% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 76.00% 23.40% 0.22% 0.00% TT: 0.33%
Indica Intermediate  786 78.40% 20.10% 0.64% 0.00% TT: 0.89%
Temperate Japonica  767 0.40% 99.20% 0.26% 0.00% ATT: 0.13%
Tropical Japonica  504 0.60% 99.20% 0.20% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 70.80% 1.04% 0.00% TT: 23.96%
Intermediate  90 45.60% 45.60% 5.56% 0.00% TT: 2.22%; ATT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523549315 AT -> A LOC_Os05g40080.1 downstream_gene_variant ; 1295.0bp to feature; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N
vg0523549315 AT -> A LOC_Os05g40090.1 downstream_gene_variant ; 3638.0bp to feature; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N
vg0523549315 AT -> A LOC_Os05g40070-LOC_Os05g40080 intergenic_region ; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N
vg0523549315 AT -> ATT LOC_Os05g40080.1 downstream_gene_variant ; 1294.0bp to feature; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N
vg0523549315 AT -> ATT LOC_Os05g40090.1 downstream_gene_variant ; 3637.0bp to feature; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N
vg0523549315 AT -> ATT LOC_Os05g40070-LOC_Os05g40080 intergenic_region ; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N
vg0523549315 AT -> TT LOC_Os05g40080.1 downstream_gene_variant ; 1296.0bp to feature; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N
vg0523549315 AT -> TT LOC_Os05g40090.1 downstream_gene_variant ; 3639.0bp to feature; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N
vg0523549315 AT -> TT LOC_Os05g40070-LOC_Os05g40080 intergenic_region ; MODIFIER silent_mutation Average:51.876; most accessible tissue: Callus, score: 98.452 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0523549315 AT A -0.02 0.0 -0.01 -0.02 -0.01 -0.01
vg0523549315 AT ATT 0.18 0.04 0.0 0.04 0.06 0.07
vg0523549315 AT TT 0.09 0.04 0.01 0.03 0.03 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523549315 NA 8.57E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 1.81E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 2.13E-13 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 3.08E-10 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 6.20E-17 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 1.37E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 1.37E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 5.09E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 9.83E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 NA 9.23E-14 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523549315 3.19E-06 NA mr1718_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251