\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523491706:

Variant ID: vg0523491706 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 23491706
Reference Allele: TCCAAlternative Allele: T,CCCA
Primary Allele: TSecondary Allele: TCCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGGCTGGGGAAAAAGTAGGTCCAGGGGCAGGCCGGGTTCCGAGTCAGGTTCAAGTCTCCAAGAATTGTTTTTAATTTTTAATTTTCTTTGAAAAAGTC[TCCA/T,CCCA]
TGCGTTGTAACGGGTGAAATCTATTTTAATCTTATTATTGTTATATGGTTTAGTTAAGATGAAACTCACTGTGGGAGTTCACTTGGATATAAATTTATTT

Reverse complement sequence

AAATAAATTTATATCCAAGTGAACTCCCACAGTGAGTTTCATCTTAACTAAACCATATAACAATAATAAGATTAAAATAGATTTCACCCGTTACAACGCA[TGGA/A,TGGG]
GACTTTTTCAAAGAAAATTAAAAATTAAAAACAATTCTTGGAGACTTGAACCTGACTCGGAACCCGGCCTGCCCCTGGACCTACTTTTTCCCCAGCCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TCCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 37.30% 0.23% 0.00% CCCA: 4.34%
All Indica  2759 93.90% 5.50% 0.29% 0.00% CCCA: 0.33%
All Japonica  1512 0.50% 99.30% 0.13% 0.00% CCCA: 0.13%
Aus  269 36.10% 4.80% 0.00% 0.00% CCCA: 59.11%
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 93.30% 6.50% 0.22% 0.00% NA
Indica III  913 89.70% 10.00% 0.00% 0.00% CCCA: 0.33%
Indica Intermediate  786 95.20% 3.40% 0.64% 0.00% CCCA: 0.76%
Temperate Japonica  767 0.50% 99.00% 0.26% 0.00% CCCA: 0.26%
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 64.60% 1.04% 0.00% CCCA: 31.25%
Intermediate  90 52.20% 42.20% 0.00% 0.00% CCCA: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523491706 TCCA -> T LOC_Os05g39980.1 upstream_gene_variant ; 114.0bp to feature; MODIFIER silent_mutation Average:78.313; most accessible tissue: Minghui63 root, score: 92.801 N N N N
vg0523491706 TCCA -> T LOC_Os05g39970.1 downstream_gene_variant ; 4499.0bp to feature; MODIFIER silent_mutation Average:78.313; most accessible tissue: Minghui63 root, score: 92.801 N N N N
vg0523491706 TCCA -> T LOC_Os05g39990.1 downstream_gene_variant ; 3899.0bp to feature; MODIFIER silent_mutation Average:78.313; most accessible tissue: Minghui63 root, score: 92.801 N N N N
vg0523491706 TCCA -> T LOC_Os05g39980-LOC_Os05g39990 intergenic_region ; MODIFIER silent_mutation Average:78.313; most accessible tissue: Minghui63 root, score: 92.801 N N N N
vg0523491706 TCCA -> CCCA LOC_Os05g39980.1 upstream_gene_variant ; 113.0bp to feature; MODIFIER silent_mutation Average:78.313; most accessible tissue: Minghui63 root, score: 92.801 N N N N
vg0523491706 TCCA -> CCCA LOC_Os05g39970.1 downstream_gene_variant ; 4498.0bp to feature; MODIFIER silent_mutation Average:78.313; most accessible tissue: Minghui63 root, score: 92.801 N N N N
vg0523491706 TCCA -> CCCA LOC_Os05g39990.1 downstream_gene_variant ; 3900.0bp to feature; MODIFIER silent_mutation Average:78.313; most accessible tissue: Minghui63 root, score: 92.801 N N N N
vg0523491706 TCCA -> CCCA LOC_Os05g39980-LOC_Os05g39990 intergenic_region ; MODIFIER silent_mutation Average:78.313; most accessible tissue: Minghui63 root, score: 92.801 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523491706 NA 1.47E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523491706 NA 1.77E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523491706 3.08E-06 NA mr1718_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251