Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0523491706:

Variant ID: vg0523491706 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 23491706
Reference Allele: TCCA	Alternative Allele: T,CCCA
Primary Allele: T	Secondary Allele: TCCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGGCTGGGGAAAAAGTAGGTCCAGGGGCAGGCCGGGTTCCGAGTCAGGTTCAAGTCTCCAAGAATTGTTTTTAATTTTTAATTTTCTTTGAAAAAGTC[TCCA/T,CCCA]
TGCGTTGTAACGGGTGAAATCTATTTTAATCTTATTATTGTTATATGGTTTAGTTAAGATGAAACTCACTGTGGGAGTTCACTTGGATATAAATTTATTT

Reverse complement sequence

AAATAAATTTATATCCAAGTGAACTCCCACAGTGAGTTTCATCTTAACTAAACCATATAACAATAATAAGATTAAAATAGATTTCACCCGTTACAACGCA[TGGA/A,TGGG]
GACTTTTTCAAAGAAAATTAAAAATTAAAAACAATTCTTGGAGACTTGAACCTGACTCGGAACCCGGCCTGCCCCTGGACCTACTTTTTCCCCAGCCTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of TCCA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	37.30%	0.23%	0.00%	CCCA: 4.34%
All Indica	2759	93.90%	5.50%	0.29%	0.00%	CCCA: 0.33%
All Japonica	1512	0.50%	99.30%	0.13%	0.00%	CCCA: 0.13%
Aus	269	36.10%	4.80%	0.00%	0.00%	CCCA: 59.11%
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	93.30%	6.50%	0.22%	0.00%	NA
Indica III	913	89.70%	10.00%	0.00%	0.00%	CCCA: 0.33%
Indica Intermediate	786	95.20%	3.40%	0.64%	0.00%	CCCA: 0.76%
Temperate Japonica	767	0.50%	99.00%	0.26%	0.00%	CCCA: 0.26%
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	64.60%	1.04%	0.00%	CCCA: 31.25%
Intermediate	90	52.20%	42.20%	0.00%	0.00%	CCCA: 5.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523491706	TCCA -> T	LOC_Os05g39980.1	upstream_gene_variant ; 114.0bp to feature; MODIFIER	silent_mutation	Average:78.313; most accessible tissue: Minghui63 root, score: 92.801	N	N	N	N
vg0523491706	TCCA -> T	LOC_Os05g39970.1	downstream_gene_variant ; 4499.0bp to feature; MODIFIER	silent_mutation	Average:78.313; most accessible tissue: Minghui63 root, score: 92.801	N	N	N	N
vg0523491706	TCCA -> T	LOC_Os05g39990.1	downstream_gene_variant ; 3899.0bp to feature; MODIFIER	silent_mutation	Average:78.313; most accessible tissue: Minghui63 root, score: 92.801	N	N	N	N
vg0523491706	TCCA -> T	LOC_Os05g39980-LOC_Os05g39990	intergenic_region ; MODIFIER	silent_mutation	Average:78.313; most accessible tissue: Minghui63 root, score: 92.801	N	N	N	N
vg0523491706	TCCA -> CCCA	LOC_Os05g39980.1	upstream_gene_variant ; 113.0bp to feature; MODIFIER	silent_mutation	Average:78.313; most accessible tissue: Minghui63 root, score: 92.801	N	N	N	N
vg0523491706	TCCA -> CCCA	LOC_Os05g39970.1	downstream_gene_variant ; 4498.0bp to feature; MODIFIER	silent_mutation	Average:78.313; most accessible tissue: Minghui63 root, score: 92.801	N	N	N	N
vg0523491706	TCCA -> CCCA	LOC_Os05g39990.1	downstream_gene_variant ; 3900.0bp to feature; MODIFIER	silent_mutation	Average:78.313; most accessible tissue: Minghui63 root, score: 92.801	N	N	N	N
vg0523491706	TCCA -> CCCA	LOC_Os05g39980-LOC_Os05g39990	intergenic_region ; MODIFIER	silent_mutation	Average:78.313; most accessible tissue: Minghui63 root, score: 92.801	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523491706	NA	1.47E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523491706	NA	1.77E-09	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523491706	3.08E-06	NA	mr1718_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251