\
| Variant ID: vg0523265069 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23265069 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.20, others allele: 0.00, population size: 76. )
CCTCGCTGACGAAGTAGACAGGCCGCTGCACCTTTCGGGGGGGCCGGTTCGTGCTGTCAAGGGCTGGTAACTCGGGGCGCACCTGTTCGGAGGTCCTGGG[G/A]
GGATCCCAGACTGCCTCGGGATCATCAAGCTCAGGGCCACCTGCCAAAGCCTCCGCTCCTCCCTTGGGGGCCTCGGGGCCCTCCTGGGGGCTAGAAGCTT
AAGCTTCTAGCCCCCAGGAGGGCCCCGAGGCCCCCAAGGGAGGAGCGGAGGCTTTGGCAGGTGGCCCTGAGCTTGATGATCCCGAGGCAGTCTGGGATCC[C/T]
CCCAGGACCTCCGAACAGGTGCGCCCCGAGTTACCAGCCCTTGACAGCACGAACCGGCCCCCCCGAAAGGTGCAGCGGCCTGTCTACTTCGTCAGCGAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 39.10% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 90.80% | 9.00% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 1.50% | 98.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 6.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 93.80% | 6.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 8.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 96.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 40.60% | 59.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 47.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523265069 | G -> A | LOC_Os05g39620.1 | synonymous_variant ; p.Pro709Pro; LOW | synonymous_codon | Average:58.566; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523265069 | NA | 3.09E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0523265069 | NA | 2.04E-31 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 2.18E-16 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 2.27E-35 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 2.60E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 1.64E-17 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | 8.19E-06 | 6.42E-42 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 1.35E-13 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 6.40E-06 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | 1.31E-06 | 1.44E-39 | mr1828 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 8.26E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 1.20E-17 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523265069 | NA | 2.68E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |