\
| Variant ID: vg0523223119 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23223119 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGATCCCACCCTAAATTTGTTCACCATGTCACATTGAACGTTTGAACATCTGCATGAAGTATTAAATATAGGCTAAAAATAACTAATTGCACAGATTGCG[A/G]
CTAATTTGCGAGACGAATCTTTTAAGCCTAATTGCTCCATGATTTGACAATGTGGTGCTACAGTAAACAATCGCTGGTTTACGGACGGATTATGTAATTA
TAATTACATAATCCGTCCGTAAACCAGCGATTGTTTACTGTAGCACCACATTGTCAAATCATGGAGCAATTAGGCTTAAAAGATTCGTCTCGCAAATTAG[T/C]
CGCAATCTGTGCAATTAGTTATTTTTAGCCTATATTTAATACTTCATGCAGATGTTCAAACGTTCAATGTGACATGGTGAACAAATTTAGGGTGGGATCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 52.80% | 47.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523223119 | A -> G | LOC_Os05g39570.1 | upstream_gene_variant ; 2055.0bp to feature; MODIFIER | silent_mutation | Average:40.059; most accessible tissue: Zhenshan97 flower, score: 67.623 | N | N | N | N |
| vg0523223119 | A -> G | LOC_Os05g39560.1 | downstream_gene_variant ; 3836.0bp to feature; MODIFIER | silent_mutation | Average:40.059; most accessible tissue: Zhenshan97 flower, score: 67.623 | N | N | N | N |
| vg0523223119 | A -> G | LOC_Os05g39560-LOC_Os05g39570 | intergenic_region ; MODIFIER | silent_mutation | Average:40.059; most accessible tissue: Zhenshan97 flower, score: 67.623 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523223119 | 4.38E-06 | NA | mr1559 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523223119 | NA | 3.43E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523223119 | NA | 4.56E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523223119 | NA | 7.61E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523223119 | NA | 8.14E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523223119 | NA | 4.61E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523223119 | NA | 9.86E-13 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523223119 | NA | 1.40E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |