\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523131395:

Variant ID: vg0523131395 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23131395
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CACAGAGGAGGAGGCAAACCCTAGATTAATTTCGCGTGTGTTGCGTGAATGCGGCGGCACGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCA[C/T]
GATCTCCACTCTACGTAACCAAGCAGGATAAGTCGCGCGTTACTTATCCGGACTCCACACCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAACAAC

Reverse complement sequence

GTTGTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGTGTGGAGTCCGGATAAGTAACGCGCGACTTATCCTGCTTGGTTACGTAGAGTGGAGATC[G/A]
TGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGTGCCGCCGCATTCACGCAACACACGCGAAATTAATCTAGGGTTTGCCTCCTCCTCTGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 18.40% 33.07% 6.16% NA
All Indica  2759 12.10% 29.70% 48.06% 10.08% NA
All Japonica  1512 99.10% 0.20% 0.66% 0.00% NA
Aus  269 21.20% 14.10% 62.83% 1.86% NA
Indica I  595 6.60% 27.70% 55.63% 10.08% NA
Indica II  465 9.90% 31.00% 41.94% 17.20% NA
Indica III  913 16.40% 30.60% 48.41% 4.60% NA
Indica Intermediate  786 12.70% 29.50% 45.55% 12.21% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 98.40% 0.40% 1.19% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 70.80% 0.00% 29.17% 0.00% NA
Intermediate  90 46.70% 11.10% 33.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523131395 C -> T LOC_Os05g39430.1 upstream_gene_variant ; 554.0bp to feature; MODIFIER silent_mutation Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0523131395 C -> T LOC_Os05g39440.1 downstream_gene_variant ; 642.0bp to feature; MODIFIER silent_mutation Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0523131395 C -> T LOC_Os05g39430-LOC_Os05g39440 intergenic_region ; MODIFIER silent_mutation Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0523131395 C -> DEL N N silent_mutation Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523131395 3.14E-06 NA mr1223_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395 NA 1.37E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395 NA 2.06E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395 NA 4.52E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395 NA 2.20E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395 NA 2.38E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395 NA 8.81E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395 NA 1.76E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395 NA 6.37E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251