\
| Variant ID: vg0523131395 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23131395 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )
CACAGAGGAGGAGGCAAACCCTAGATTAATTTCGCGTGTGTTGCGTGAATGCGGCGGCACGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCA[C/T]
GATCTCCACTCTACGTAACCAAGCAGGATAAGTCGCGCGTTACTTATCCGGACTCCACACCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAACAAC
GTTGTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGTGTGGAGTCCGGATAAGTAACGCGCGACTTATCCTGCTTGGTTACGTAGAGTGGAGATC[G/A]
TGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGTGCCGCCGCATTCACGCAACACACGCGAAATTAATCTAGGGTTTGCCTCCTCCTCTGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 18.40% | 33.07% | 6.16% | NA |
| All Indica | 2759 | 12.10% | 29.70% | 48.06% | 10.08% | NA |
| All Japonica | 1512 | 99.10% | 0.20% | 0.66% | 0.00% | NA |
| Aus | 269 | 21.20% | 14.10% | 62.83% | 1.86% | NA |
| Indica I | 595 | 6.60% | 27.70% | 55.63% | 10.08% | NA |
| Indica II | 465 | 9.90% | 31.00% | 41.94% | 17.20% | NA |
| Indica III | 913 | 16.40% | 30.60% | 48.41% | 4.60% | NA |
| Indica Intermediate | 786 | 12.70% | 29.50% | 45.55% | 12.21% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 0.40% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 29.17% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 11.10% | 33.33% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523131395 | C -> T | LOC_Os05g39430.1 | upstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0523131395 | C -> T | LOC_Os05g39440.1 | downstream_gene_variant ; 642.0bp to feature; MODIFIER | silent_mutation | Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0523131395 | C -> T | LOC_Os05g39430-LOC_Os05g39440 | intergenic_region ; MODIFIER | silent_mutation | Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0523131395 | C -> DEL | N | N | silent_mutation | Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523131395 | 3.14E-06 | NA | mr1223_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523131395 | NA | 1.37E-22 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523131395 | NA | 2.06E-21 | mr1551_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523131395 | NA | 4.52E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523131395 | NA | 2.20E-12 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523131395 | NA | 2.38E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523131395 | NA | 8.81E-35 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523131395 | NA | 1.76E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523131395 | NA | 6.37E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |