\
| Variant ID: vg0523035315 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 23035315 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )
AGCCGATTGACTTCTCACCAGCCGATAAATATAACCTAAACGGTATCCCTTTCTGTGGAGGAATCAAAACAGGAGGAGAGCTGAGATACTCCTTGATATT[A/T]
TCCAAAGCCTTTTGCTGCTCTGCCCCCCAAGTGAATTGCTGATTGGCTTTTAATTTCAATAAGGGTGTAAAAGGTTCCAACCTCCTGGACAAATTTGAAA
TTTCAAATTTGTCCAGGAGGTTGGAACCTTTTACACCCTTATTGAAATTAAAAGCCAATCAGCAATTCACTTGGGGGGCAGAGCAGCAAAAGGCTTTGGA[T/A]
AATATCAAGGAGTATCTCAGCTCTCCTCCTGTTTTGATTCCTCCACAGAAAGGGATACCGTTTAGGTTATATTTATCGGCTGGTGAGAAGTCAATCGGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 1.60% | 1.33% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 65.40% | 16.70% | 17.84% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 65.60% | 25.00% | 9.38% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0523035315 | A -> T | LOC_Os05g39280.1 | missense_variant ; p.Asp775Glu; MODERATE | nonsynonymous_codon ; D775E | Average:35.799; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | benign |
0.784 |
TOLERATED | 0.09 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0523035315 | 8.86E-06 | 6.52E-06 | mr1685 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | NA | 7.43E-10 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | NA | 4.26E-08 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | NA | 7.25E-06 | mr1127_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | NA | 3.92E-11 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | NA | 1.75E-08 | mr1465_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | NA | 2.94E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | NA | 2.72E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | 9.74E-07 | 5.72E-16 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | NA | 1.14E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | 4.16E-06 | NA | mr1915_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0523035315 | 2.38E-06 | NA | mr1940_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |