\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522637550:

Variant ID: vg0522637550 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22637550
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCTCAAGATTTGTGAGGATGAGTTTGGTAATCTATTTTGAAAGGCCGAACTTTTTTAGACCCAAAAAACTAGATTGAACTCTCGATTTAGACCGAACG[C/T]
ACATCCCTACCCTACACTTAATACAGAATGAGGTGCAGGTGACACACCTCATCCCGTCCTAAAGCTTGGACTAGGGACCCACAAATGGTAGCCCAGTGAC

Reverse complement sequence

GTCACTGGGCTACCATTTGTGGGTCCCTAGTCCAAGCTTTAGGACGGGATGAGGTGTGTCACCTGCACCTCATTCTGTATTAAGTGTAGGGTAGGGATGT[G/A]
CGTTCGGTCTAAATCGAGAGTTCAATCTAGTTTTTTGGGTCTAAAAAAGTTCGGCCTTTCAAAATAGATTACCAAACTCATCCTCACAAATCTTGAGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 13.60% 0.08% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 59.10% 40.70% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 93.40% 6.30% 0.39% 0.00% NA
Tropical Japonica  504 13.30% 86.50% 0.20% 0.00% NA
Japonica Intermediate  241 45.60% 54.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522637550 C -> T LOC_Os05g38590.1 upstream_gene_variant ; 1426.0bp to feature; MODIFIER silent_mutation Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0522637550 C -> T LOC_Os05g38590.2 upstream_gene_variant ; 1426.0bp to feature; MODIFIER silent_mutation Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0522637550 C -> T LOC_Os05g38590.3 upstream_gene_variant ; 1426.0bp to feature; MODIFIER silent_mutation Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0522637550 C -> T LOC_Os05g38600.1 downstream_gene_variant ; 944.0bp to feature; MODIFIER silent_mutation Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0522637550 C -> T LOC_Os05g38610.1 downstream_gene_variant ; 4075.0bp to feature; MODIFIER silent_mutation Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0522637550 C -> T LOC_Os05g38590-LOC_Os05g38600 intergenic_region ; MODIFIER silent_mutation Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522637550 1.57E-06 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 7.41E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 1.27E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 3.94E-16 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 2.29E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 1.75E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 3.03E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 1.24E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 2.16E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 4.03E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 3.76E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 3.61E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 6.31E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 9.95E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 1.47E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 9.13E-11 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 3.44E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 7.05E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 4.10E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 3.43E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 2.35E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 8.07E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 2.01E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 6.22E-07 NA mr1619_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 2.36E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 1.46E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 1.27E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550 NA 2.52E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251