Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522637550:

Variant ID: vg0522637550 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 22637550
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCTCAAGATTTGTGAGGATGAGTTTGGTAATCTATTTTGAAAGGCCGAACTTTTTTAGACCCAAAAAACTAGATTGAACTCTCGATTTAGACCGAACG[C/T]
ACATCCCTACCCTACACTTAATACAGAATGAGGTGCAGGTGACACACCTCATCCCGTCCTAAAGCTTGGACTAGGGACCCACAAATGGTAGCCCAGTGAC

Reverse complement sequence

GTCACTGGGCTACCATTTGTGGGTCCCTAGTCCAAGCTTTAGGACGGGATGAGGTGTGTCACCTGCACCTCATTCTGTATTAAGTGTAGGGTAGGGATGT[G/A]
CGTTCGGTCTAAATCGAGAGTTCAATCTAGTTTTTTGGGTCTAAAAAAGTTCGGCCTTTCAAAATAGATTACCAAACTCATCCTCACAAATCTTGAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.30%	13.60%	0.08%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	59.10%	40.70%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	93.40%	6.30%	0.39%	0.00%	NA
Tropical Japonica	504	13.30%	86.50%	0.20%	0.00%	NA
Japonica Intermediate	241	45.60%	54.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0522637550	C -> T	LOC_Os05g38590.1	upstream_gene_variant ; 1426.0bp to feature; MODIFIER	silent_mutation	Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0522637550	C -> T	LOC_Os05g38590.2	upstream_gene_variant ; 1426.0bp to feature; MODIFIER	silent_mutation	Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0522637550	C -> T	LOC_Os05g38590.3	upstream_gene_variant ; 1426.0bp to feature; MODIFIER	silent_mutation	Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0522637550	C -> T	LOC_Os05g38600.1	downstream_gene_variant ; 944.0bp to feature; MODIFIER	silent_mutation	Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0522637550	C -> T	LOC_Os05g38610.1	downstream_gene_variant ; 4075.0bp to feature; MODIFIER	silent_mutation	Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0522637550	C -> T	LOC_Os05g38590-LOC_Os05g38600	intergenic_region ; MODIFIER	silent_mutation	Average:66.888; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0522637550	1.57E-06	NA	mr1071	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	7.41E-06	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	1.27E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	3.94E-16	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	2.29E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	1.75E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	3.03E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	1.24E-28	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	2.16E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	4.03E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	3.76E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	3.61E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	6.31E-07	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	9.95E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	1.47E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	9.13E-11	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	3.44E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	7.05E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	4.10E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	3.43E-09	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	2.35E-13	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	8.07E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	2.01E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	6.22E-07	NA	mr1619_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	2.36E-29	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	1.46E-13	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	1.27E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522637550	NA	2.52E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251