Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0522576271:

Variant ID: vg0522576271 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 22576271
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CAGGGTGCTTTTTGACTCAGCAGCCCGTATTCCGGCTGAAAACTTCCACAGAGAGGGCACACAAGATATAGTAAATACAACAAAGAAAGGTTTTTTTTTT[C/A]
TAGACATGCAGAAAAGTTGCATTTTTATAGTGAACAGAGATTTCAGTGTGTATTATCTTGTCGGTAATCATACACAAGCTAGTTGCGATTTACAAACTAC

Reverse complement sequence

GTAGTTTGTAAATCGCAACTAGCTTGTGTATGATTACCGACAAGATAATACACACTGAAATCTCTGTTCACTATAAAAATGCAACTTTTCTGCATGTCTA[G/T]
AAAAAAAAAACCTTTCTTTGTTGTATTTACTATATCTTGTGTGCCCTCTCTGTGGAAGTTTTCAGCCGGAATACGGGCTGCTGAGTCAAAAAGCACCCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	43.40%	0.02%	0.11%	NA
All Indica	2759	89.20%	10.70%	0.00%	0.11%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.07%	NA
Aus	269	56.10%	43.50%	0.37%	0.00%	NA
Indica I	595	65.70%	34.30%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	97.80%	2.10%	0.00%	0.11%	NA
Indica Intermediate	786	92.10%	7.60%	0.00%	0.25%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.00%	0.00%	0.20%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	94.80%	0.00%	1.04%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0522576271	C -> DEL	N	N	silent_mutation	Average:45.495; most accessible tissue: Callus, score: 82.394	N	N	N	N
vg0522576271	C -> A	LOC_Os05g38490.1	upstream_gene_variant ; 4066.0bp to feature; MODIFIER	silent_mutation	Average:45.495; most accessible tissue: Callus, score: 82.394	N	N	N	N
vg0522576271	C -> A	LOC_Os05g38480.1	intron_variant ; MODIFIER	silent_mutation	Average:45.495; most accessible tissue: Callus, score: 82.394	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0522576271	NA	2.24E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271	NA	1.91E-06	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271	NA	1.56E-07	mr1798	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271	NA	8.45E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271	NA	2.95E-08	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271	NA	1.26E-06	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271	NA	7.42E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251