\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522576271:

Variant ID: vg0522576271 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22576271
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGGTGCTTTTTGACTCAGCAGCCCGTATTCCGGCTGAAAACTTCCACAGAGAGGGCACACAAGATATAGTAAATACAACAAAGAAAGGTTTTTTTTTT[C/A]
TAGACATGCAGAAAAGTTGCATTTTTATAGTGAACAGAGATTTCAGTGTGTATTATCTTGTCGGTAATCATACACAAGCTAGTTGCGATTTACAAACTAC

Reverse complement sequence

GTAGTTTGTAAATCGCAACTAGCTTGTGTATGATTACCGACAAGATAATACACACTGAAATCTCTGTTCACTATAAAAATGCAACTTTTCTGCATGTCTA[G/T]
AAAAAAAAAACCTTTCTTTGTTGTATTTACTATATCTTGTGTGCCCTCTCTGTGGAAGTTTTCAGCCGGAATACGGGCTGCTGAGTCAAAAAGCACCCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 43.40% 0.02% 0.11% NA
All Indica  2759 89.20% 10.70% 0.00% 0.11% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.07% NA
Aus  269 56.10% 43.50% 0.37% 0.00% NA
Indica I  595 65.70% 34.30% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 97.80% 2.10% 0.00% 0.11% NA
Indica Intermediate  786 92.10% 7.60% 0.00% 0.25% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.00% 0.00% 0.20% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 94.80% 0.00% 1.04% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522576271 C -> DEL N N silent_mutation Average:45.495; most accessible tissue: Callus, score: 82.394 N N N N
vg0522576271 C -> A LOC_Os05g38490.1 upstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:45.495; most accessible tissue: Callus, score: 82.394 N N N N
vg0522576271 C -> A LOC_Os05g38480.1 intron_variant ; MODIFIER silent_mutation Average:45.495; most accessible tissue: Callus, score: 82.394 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522576271 NA 2.24E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271 NA 1.91E-06 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271 NA 1.56E-07 mr1798 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271 NA 8.45E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271 NA 2.95E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271 NA 1.26E-06 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522576271 NA 7.42E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251