\
| Variant ID: vg0522576271 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 22576271 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
CAGGGTGCTTTTTGACTCAGCAGCCCGTATTCCGGCTGAAAACTTCCACAGAGAGGGCACACAAGATATAGTAAATACAACAAAGAAAGGTTTTTTTTTT[C/A]
TAGACATGCAGAAAAGTTGCATTTTTATAGTGAACAGAGATTTCAGTGTGTATTATCTTGTCGGTAATCATACACAAGCTAGTTGCGATTTACAAACTAC
GTAGTTTGTAAATCGCAACTAGCTTGTGTATGATTACCGACAAGATAATACACACTGAAATCTCTGTTCACTATAAAAATGCAACTTTTCTGCATGTCTA[G/T]
AAAAAAAAAACCTTTCTTTGTTGTATTTACTATATCTTGTGTGCCCTCTCTGTGGAAGTTTTCAGCCGGAATACGGGCTGCTGAGTCAAAAAGCACCCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.50% | 43.40% | 0.02% | 0.11% | NA |
| All Indica | 2759 | 89.20% | 10.70% | 0.00% | 0.11% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.00% | 0.07% | NA |
| Aus | 269 | 56.10% | 43.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 65.70% | 34.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 92.10% | 7.60% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522576271 | C -> DEL | N | N | silent_mutation | Average:45.495; most accessible tissue: Callus, score: 82.394 | N | N | N | N |
| vg0522576271 | C -> A | LOC_Os05g38490.1 | upstream_gene_variant ; 4066.0bp to feature; MODIFIER | silent_mutation | Average:45.495; most accessible tissue: Callus, score: 82.394 | N | N | N | N |
| vg0522576271 | C -> A | LOC_Os05g38480.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.495; most accessible tissue: Callus, score: 82.394 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522576271 | NA | 2.24E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522576271 | NA | 1.91E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522576271 | NA | 1.56E-07 | mr1798 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522576271 | NA | 8.45E-12 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522576271 | NA | 2.95E-08 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522576271 | NA | 1.26E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522576271 | NA | 7.42E-06 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |