Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0522473219:

Variant ID: vg0522473219 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 22473219
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

CACATGCATGTGGAGCCCGCCTTTTGCCAGGTGTGTCTCCATACCTGTTTAGCAAAGGCGCATTCCATGAGGAGGTGCGTTGTTGTCTCCGGTTCTACTC[C/T]
ACACAGAGGACAAATGTGGCTGTTGTCCCATCCACGAAGCTGGAGTTTGTCGGCTGTGAGGATCTTTCTATGGATCATGAGCCAACCAAAGAATTTGGAT

Reverse complement sequence

ATCCAAATTCTTTGGTTGGCTCATGATCCATAGAAAGATCCTCACAGCCGACAAACTCCAGCTTCGTGGATGGGACAACAGCCACATTTGTCCTCTGTGT[G/A]
GAGTAGAACCGGAGACAACAACGCACCTCCTCATGGAATGCGCCTTTGCTAAACAGGTATGGAGACACACCTGGCAAAAGGCGGGCTCCACATGCATGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	12.40%	0.80%	0.00%	NA
All Indica	2759	77.90%	20.80%	1.34%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	82.00%	13.80%	4.20%	0.00%	NA
Indica II	465	72.50%	26.70%	0.86%	0.00%	NA
Indica III	913	79.60%	20.30%	0.11%	0.00%	NA
Indica Intermediate	786	76.00%	23.20%	0.89%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0522473219	C -> T	LOC_Os05g38330.1	upstream_gene_variant ; 1147.0bp to feature; MODIFIER	silent_mutation	Average:48.173; most accessible tissue: Minghui63 flower, score: 58.22	N	N	N	N
vg0522473219	C -> T	LOC_Os05g38330.2	upstream_gene_variant ; 1147.0bp to feature; MODIFIER	silent_mutation	Average:48.173; most accessible tissue: Minghui63 flower, score: 58.22	N	N	N	N
vg0522473219	C -> T	LOC_Os05g38340.1	downstream_gene_variant ; 685.0bp to feature; MODIFIER	silent_mutation	Average:48.173; most accessible tissue: Minghui63 flower, score: 58.22	N	N	N	N
vg0522473219	C -> T	LOC_Os05g38330-LOC_Os05g38340	intergenic_region ; MODIFIER	silent_mutation	Average:48.173; most accessible tissue: Minghui63 flower, score: 58.22	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0522473219	3.56E-06	3.26E-06	mr1029	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219	NA	3.24E-06	mr1279	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219	NA	3.39E-06	mr1468	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219	NA	7.02E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219	NA	7.30E-06	mr1625	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219	NA	2.61E-06	mr1725	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219	7.69E-06	5.32E-06	mr1993	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219	6.49E-06	6.49E-06	mr1581_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251