\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522473219:

Variant ID: vg0522473219 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22473219
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


CACATGCATGTGGAGCCCGCCTTTTGCCAGGTGTGTCTCCATACCTGTTTAGCAAAGGCGCATTCCATGAGGAGGTGCGTTGTTGTCTCCGGTTCTACTC[C/T]
ACACAGAGGACAAATGTGGCTGTTGTCCCATCCACGAAGCTGGAGTTTGTCGGCTGTGAGGATCTTTCTATGGATCATGAGCCAACCAAAGAATTTGGAT

Reverse complement sequence

ATCCAAATTCTTTGGTTGGCTCATGATCCATAGAAAGATCCTCACAGCCGACAAACTCCAGCTTCGTGGATGGGACAACAGCCACATTTGTCCTCTGTGT[G/A]
GAGTAGAACCGGAGACAACAACGCACCTCCTCATGGAATGCGCCTTTGCTAAACAGGTATGGAGACACACCTGGCAAAAGGCGGGCTCCACATGCATGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 12.40% 0.80% 0.00% NA
All Indica  2759 77.90% 20.80% 1.34% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 82.00% 13.80% 4.20% 0.00% NA
Indica II  465 72.50% 26.70% 0.86% 0.00% NA
Indica III  913 79.60% 20.30% 0.11% 0.00% NA
Indica Intermediate  786 76.00% 23.20% 0.89% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522473219 C -> T LOC_Os05g38330.1 upstream_gene_variant ; 1147.0bp to feature; MODIFIER silent_mutation Average:48.173; most accessible tissue: Minghui63 flower, score: 58.22 N N N N
vg0522473219 C -> T LOC_Os05g38330.2 upstream_gene_variant ; 1147.0bp to feature; MODIFIER silent_mutation Average:48.173; most accessible tissue: Minghui63 flower, score: 58.22 N N N N
vg0522473219 C -> T LOC_Os05g38340.1 downstream_gene_variant ; 685.0bp to feature; MODIFIER silent_mutation Average:48.173; most accessible tissue: Minghui63 flower, score: 58.22 N N N N
vg0522473219 C -> T LOC_Os05g38330-LOC_Os05g38340 intergenic_region ; MODIFIER silent_mutation Average:48.173; most accessible tissue: Minghui63 flower, score: 58.22 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522473219 3.56E-06 3.26E-06 mr1029 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219 NA 3.24E-06 mr1279 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219 NA 3.39E-06 mr1468 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219 NA 7.02E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219 NA 7.30E-06 mr1625 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219 NA 2.61E-06 mr1725 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219 7.69E-06 5.32E-06 mr1993 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522473219 6.49E-06 6.49E-06 mr1581_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251