\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522255261:

Variant ID: vg0522255261 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22255261
Reference Allele: AAlternative Allele: C,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, A: 0.26, G: 0.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTAGAGAATTCCCGCACAGCAATTTTTCACCCGTTGTCTACAGGATTAACATGATTTAATTTGTGATTATTTCCATAATTACATGACTATGCGCATTG[A/C,G]
TCGGTAGCACCAAACATTTCCATGTTTTCAATTGCCCCCGATCTCCCTCAGCGCCATATTAATAGCGGAGACCGGTGTCGTGGAAAGATGACAATCTCTC

Reverse complement sequence

GAGAGATTGTCATCTTTCCACGACACCGGTCTCCGCTATTAATATGGCGCTGAGGGAGATCGGGGGCAATTGAAAACATGGAAATGTTTGGTGCTACCGA[T/G,C]
CAATGCGCATAGTCATGTAATTATGGAAATAATCACAAATTAAATCATGTTAATCCTGTAGACAACGGGTGAAAAATTGCTGTGCGGGAATTCTCTAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.00% 0.13% 0.59% G: 0.04%
All Indica  2759 98.10% 1.40% 0.11% 0.36% NA
All Japonica  1512 1.10% 97.70% 0.07% 1.19% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 98.70% 0.30% 0.50% 0.50% NA
Indica II  465 98.30% 1.50% 0.00% 0.22% NA
Indica III  913 99.20% 0.70% 0.00% 0.11% NA
Indica Intermediate  786 96.30% 3.10% 0.00% 0.64% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.20% 0.20% 0.60% NA
Japonica Intermediate  241 2.10% 91.70% 0.00% 6.22% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 48.90% 46.70% 2.22% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522255261 A -> DEL N N silent_mutation Average:48.891; most accessible tissue: Callus, score: 73.179 N N N N
vg0522255261 A -> G LOC_Os05g37940.1 downstream_gene_variant ; 4634.0bp to feature; MODIFIER silent_mutation Average:48.891; most accessible tissue: Callus, score: 73.179 N N N N
vg0522255261 A -> G LOC_Os05g37940-LOC_Os05g37950 intergenic_region ; MODIFIER silent_mutation Average:48.891; most accessible tissue: Callus, score: 73.179 N N N N
vg0522255261 A -> C LOC_Os05g37940.1 downstream_gene_variant ; 4634.0bp to feature; MODIFIER silent_mutation Average:48.891; most accessible tissue: Callus, score: 73.179 N N N N
vg0522255261 A -> C LOC_Os05g37940-LOC_Os05g37950 intergenic_region ; MODIFIER silent_mutation Average:48.891; most accessible tissue: Callus, score: 73.179 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522255261 NA 5.06E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 5.62E-78 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.40E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.40E-26 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 5.53E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 7.73E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.50E-56 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.56E-66 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 8.74E-73 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 4.07E-06 2.25E-91 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 3.08E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 2.14E-55 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.59E-42 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 2.12E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.41E-27 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.49E-74 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 2.91E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 2.96E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.09E-84 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 6.63E-39 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 3.75E-121 mr1718_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 2.69E-49 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 3.89E-62 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 4.46E-88 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 1.56E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 2.77E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522255261 NA 2.03E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251