\
| Variant ID: vg0522255261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 22255261 |
| Reference Allele: A | Alternative Allele: C,G |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, A: 0.26, G: 0.00, others allele: 0.00, population size: 213. )
ATCTAGAGAATTCCCGCACAGCAATTTTTCACCCGTTGTCTACAGGATTAACATGATTTAATTTGTGATTATTTCCATAATTACATGACTATGCGCATTG[A/C,G]
TCGGTAGCACCAAACATTTCCATGTTTTCAATTGCCCCCGATCTCCCTCAGCGCCATATTAATAGCGGAGACCGGTGTCGTGGAAAGATGACAATCTCTC
GAGAGATTGTCATCTTTCCACGACACCGGTCTCCGCTATTAATATGGCGCTGAGGGAGATCGGGGGCAATTGAAAACATGGAAATGTTTGGTGCTACCGA[T/G,C]
CAATGCGCATAGTCATGTAATTATGGAAATAATCACAAATTAAATCATGTTAATCCTGTAGACAACGGGTGAAAAATTGCTGTGCGGGAATTCTCTAGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 36.00% | 0.13% | 0.59% | G: 0.04% |
| All Indica | 2759 | 98.10% | 1.40% | 0.11% | 0.36% | NA |
| All Japonica | 1512 | 1.10% | 97.70% | 0.07% | 1.19% | NA |
| Aus | 269 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.30% | 0.50% | 0.50% | NA |
| Indica II | 465 | 98.30% | 1.50% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 96.30% | 3.10% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 98.20% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 2.10% | 91.70% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 46.70% | 2.22% | 0.00% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522255261 | A -> DEL | N | N | silent_mutation | Average:48.891; most accessible tissue: Callus, score: 73.179 | N | N | N | N |
| vg0522255261 | A -> G | LOC_Os05g37940.1 | downstream_gene_variant ; 4634.0bp to feature; MODIFIER | silent_mutation | Average:48.891; most accessible tissue: Callus, score: 73.179 | N | N | N | N |
| vg0522255261 | A -> G | LOC_Os05g37940-LOC_Os05g37950 | intergenic_region ; MODIFIER | silent_mutation | Average:48.891; most accessible tissue: Callus, score: 73.179 | N | N | N | N |
| vg0522255261 | A -> C | LOC_Os05g37940.1 | downstream_gene_variant ; 4634.0bp to feature; MODIFIER | silent_mutation | Average:48.891; most accessible tissue: Callus, score: 73.179 | N | N | N | N |
| vg0522255261 | A -> C | LOC_Os05g37940-LOC_Os05g37950 | intergenic_region ; MODIFIER | silent_mutation | Average:48.891; most accessible tissue: Callus, score: 73.179 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522255261 | NA | 5.06E-29 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 5.62E-78 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.40E-40 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.40E-26 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 5.53E-31 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 7.73E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.50E-56 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.56E-66 | mr1619 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 8.74E-73 | mr1629 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | 4.07E-06 | 2.25E-91 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 3.08E-34 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 2.14E-55 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.59E-42 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 2.12E-39 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.41E-27 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.49E-74 | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 2.91E-25 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 2.96E-23 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.09E-84 | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 6.63E-39 | mr1689_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 3.75E-121 | mr1718_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 2.69E-49 | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 3.89E-62 | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 4.46E-88 | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 1.56E-35 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 2.77E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522255261 | NA | 2.03E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |