\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522018946:

Variant ID: vg0522018946 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22018946
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CCACTACGGTCTGATCGATTTCCTCGAGGGAAAACCAGATTTTTGCCACTTTGATTTTGCAAAGGCAATCTCTCTCTTCTTTTTCTATTTATGAGCTAAT[C/T]
TGAAACAAAAACCAACAATATGTCCATCTTTTCCACAAAAAGAACAAGTATATTTTTCACGATGATTAGACATATTGGTAGCACTAGTAGATTTAGCAAC

Reverse complement sequence

GTTGCTAAATCTACTAGTGCTACCAATATGTCTAATCATCGTGAAAAATATACTTGTTCTTTTTGTGGAAAAGATGGACATATTGTTGGTTTTTGTTTCA[G/A]
ATTAGCTCATAAATAGAAAAAGAAGAGAGAGATTGCCTTTGCAAAATCAAAGTGGCAAAAATCTGGTTTTCCCTCGAGGAAATCGATCAGACCGTAGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 20.70% 0.38% 0.00% NA
All Indica  2759 65.00% 34.40% 0.65% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 47.40% 50.60% 2.02% 0.00% NA
Indica II  465 87.70% 12.00% 0.22% 0.00% NA
Indica III  913 58.40% 41.30% 0.33% 0.00% NA
Indica Intermediate  786 72.40% 27.40% 0.25% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522018946 C -> T LOC_Os05g37630.1 downstream_gene_variant ; 4089.0bp to feature; MODIFIER silent_mutation Average:26.146; most accessible tissue: Zhenshan97 flower, score: 36.732 N N N N
vg0522018946 C -> T LOC_Os05g37620.1 intron_variant ; MODIFIER silent_mutation Average:26.146; most accessible tissue: Zhenshan97 flower, score: 36.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522018946 NA 1.95E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 2.87E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 2.60E-06 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 5.14E-06 mr1418 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 3.37E-06 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 1.96E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 5.88E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 3.32E-06 mr1737 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 3.86E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 7.13E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 1.99E-06 1.98E-06 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 NA 8.60E-06 mr1856 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 7.39E-07 NA mr1992 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522018946 3.08E-07 3.08E-07 mr1992 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251