\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521967774:

Variant ID: vg0521967774 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21967774
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGTGAACATGGGGGTGATGAAAATCTAAATAATTTTTTATCCAGCGGAAAAAAAACATAGGAGCAATTATTAAAAGTGGCATTTGGAGAGTGGCAAAT[A/G]
GTTGGATCCCTCATGTGTAACTTGGTACCGTGAGGCATAGATTATAGTTTTCAAAATAATAGCTATATGGTCTTTTTTTTAAGAAAAAAAACATGAGAGA

Reverse complement sequence

TCTCTCATGTTTTTTTTCTTAAAAAAAAGACCATATAGCTATTATTTTGAAAACTATAATCTATGCCTCACGGTACCAAGTTACACATGAGGGATCCAAC[T/C]
ATTTGCCACTCTCCAAATGCCACTTTTAATAATTGCTCCTATGTTTTTTTTCCGCTGGATAAAAAATTATTTAGATTTTCATCACCCCCATGTTCACGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.40% 0.30% 0.00% NA
All Indica  2759 37.90% 61.60% 0.43% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 54.30% 45.00% 0.67% 0.00% NA
Indica II  465 15.10% 84.70% 0.22% 0.00% NA
Indica III  913 42.90% 56.50% 0.55% 0.00% NA
Indica Intermediate  786 33.30% 66.40% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521967774 A -> G LOC_Os05g37520.2 upstream_gene_variant ; 1762.0bp to feature; MODIFIER silent_mutation Average:56.697; most accessible tissue: Callus, score: 76.332 N N N N
vg0521967774 A -> G LOC_Os05g37530.1 upstream_gene_variant ; 2609.0bp to feature; MODIFIER silent_mutation Average:56.697; most accessible tissue: Callus, score: 76.332 N N N N
vg0521967774 A -> G LOC_Os05g37520.1 upstream_gene_variant ; 1762.0bp to feature; MODIFIER silent_mutation Average:56.697; most accessible tissue: Callus, score: 76.332 N N N N
vg0521967774 A -> G LOC_Os05g37520-LOC_Os05g37530 intergenic_region ; MODIFIER silent_mutation Average:56.697; most accessible tissue: Callus, score: 76.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521967774 NA 3.74E-07 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 3.18E-06 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 8.24E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 4.38E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 4.53E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 2.55E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 1.30E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 2.95E-06 mr1737 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 2.07E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 4.44E-06 mr1856 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 1.16E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 8.07E-08 mr1992 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 2.34E-06 2.34E-06 mr1992 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967774 NA 2.49E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251