\
| Variant ID: vg0521967774 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 21967774 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 119. )
AGCGTGAACATGGGGGTGATGAAAATCTAAATAATTTTTTATCCAGCGGAAAAAAAACATAGGAGCAATTATTAAAAGTGGCATTTGGAGAGTGGCAAAT[A/G]
GTTGGATCCCTCATGTGTAACTTGGTACCGTGAGGCATAGATTATAGTTTTCAAAATAATAGCTATATGGTCTTTTTTTTAAGAAAAAAAACATGAGAGA
TCTCTCATGTTTTTTTTCTTAAAAAAAAGACCATATAGCTATTATTTTGAAAACTATAATCTATGCCTCACGGTACCAAGTTACACATGAGGGATCCAAC[T/C]
ATTTGCCACTCTCCAAATGCCACTTTTAATAATTGCTCCTATGTTTTTTTTCCGCTGGATAAAAAATTATTTAGATTTTCATCACCCCCATGTTCACGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 39.40% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 37.90% | 61.60% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.10% | 43.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 54.30% | 45.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 15.10% | 84.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 42.90% | 56.50% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 33.30% | 66.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 38.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0521967774 | A -> G | LOC_Os05g37520.2 | upstream_gene_variant ; 1762.0bp to feature; MODIFIER | silent_mutation | Average:56.697; most accessible tissue: Callus, score: 76.332 | N | N | N | N |
| vg0521967774 | A -> G | LOC_Os05g37530.1 | upstream_gene_variant ; 2609.0bp to feature; MODIFIER | silent_mutation | Average:56.697; most accessible tissue: Callus, score: 76.332 | N | N | N | N |
| vg0521967774 | A -> G | LOC_Os05g37520.1 | upstream_gene_variant ; 1762.0bp to feature; MODIFIER | silent_mutation | Average:56.697; most accessible tissue: Callus, score: 76.332 | N | N | N | N |
| vg0521967774 | A -> G | LOC_Os05g37520-LOC_Os05g37530 | intergenic_region ; MODIFIER | silent_mutation | Average:56.697; most accessible tissue: Callus, score: 76.332 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0521967774 | NA | 3.74E-07 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 3.18E-06 | mr1115 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 8.24E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 4.38E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 4.53E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 2.55E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 1.30E-06 | mr1735 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 2.95E-06 | mr1737 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 2.07E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 4.44E-06 | mr1856 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 1.16E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 8.07E-08 | mr1992 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | 2.34E-06 | 2.34E-06 | mr1992 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521967774 | NA | 2.49E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |