Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0521798367:

Variant ID: vg0521798367 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21798367
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAGATCGGCGGGAGTGACGACGACGAGCACAGAGAAACTGTGATAAACTGCAGGAGATGAAGCCTTGGATGTGCGGACCCAAATGGGGCCTCCACGAG[A/G]
TGGAGGTTGAGCCAACCAAAGCTAAAAGTGAAGTTTTCAGCCGCACCTGTTGAAGCCGTTGACGCTGACGAGGAAGAAGGTCAACGCTGAAGTGGAGAGG

Reverse complement sequence

CCTCTCCACTTCAGCGTTGACCTTCTTCCTCGTCAGCGTCAACGGCTTCAACAGGTGCGGCTGAAAACTTCACTTTTAGCTTTGGTTGGCTCAACCTCCA[T/C]
CTCGTGGAGGCCCCATTTGGGTCCGCACATCCAAGGCTTCATCTCCTGCAGTTTATCACAGTTTCTCTGTGCTCGTCGTCGTCACTCCCGCCGATCTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.30% 0.59% 0.00% NA
All Indica  2759 98.70% 1.10% 0.18% 0.00% NA
All Japonica  1512 13.10% 85.60% 1.32% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.00% 0.38% 0.00% NA
Temperate Japonica  767 17.50% 80.30% 2.22% 0.00% NA
Tropical Japonica  504 7.30% 92.50% 0.20% 0.00% NA
Japonica Intermediate  241 11.20% 88.00% 0.83% 0.00% NA
VI/Aromatic  96 21.90% 77.10% 1.04% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521798367 A -> G LOC_Os05g37260.1 intron_variant ; MODIFIER silent_mutation Average:88.153; most accessible tissue: Minghui63 root, score: 97.718 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0521798367 A G 0.12 0.05 0.01 0.07 0.07 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521798367 NA 2.15E-11 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0521798367 NA 8.91E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.21E-17 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 9.32E-07 mr1324 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.88E-12 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.40E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.34E-14 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 3.77E-06 3.77E-06 mr1335 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 3.29E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 2.78E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 4.57E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 9.02E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 8.15E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 5.01E-19 mr1324_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 4.68E-06 mr1324_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.89E-14 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 2.37E-15 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.65E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.61E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 6.44E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 7.33E-06 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.29E-09 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 6.69E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 3.61E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 1.94E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521798367 NA 2.78E-07 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251