\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521749530:

Variant ID: vg0521749530 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21749530
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 95. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAAGGAAGAAGTGAGGTTTTCATTTACATGTAGGGTCTATCTATAATTTTTTAATTTCTTTGTTGATTAGGCTGTCACGTAGATGTGTCAGCGAAAAT[A/C]
TCTCTCAAAACAGCTGAGAGAATCGTTTTGCCCAAATTTAGTAGTTGGAGAGGTTGATATACCCAGTTTTATAGTTGAGGATACGAGTTAGATCGACCTA

Reverse complement sequence

TAGGTCGATCTAACTCGTATCCTCAACTATAAAACTGGGTATATCAACCTCTCCAACTACTAAATTTGGGCAAAACGATTCTCTCAGCTGTTTTGAGAGA[T/G]
ATTTTCGCTGACACATCTACGTGACAGCCTAATCAACAAAGAAATTAAAAAATTATAGATAGACCCTACATGTAAATGAAAACCTCACTTCTTCCTTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.30% 0.08% 0.02% NA
All Indica  2759 98.60% 1.20% 0.11% 0.04% NA
All Japonica  1512 6.70% 93.30% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 99.50% 0.40% 0.00% 0.11% NA
Indica Intermediate  786 97.10% 2.70% 0.25% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 17.30% 82.70% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521749530 A -> DEL N N silent_mutation Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808 N N N N
vg0521749530 A -> C LOC_Os05g37200.1 upstream_gene_variant ; 1171.0bp to feature; MODIFIER silent_mutation Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808 N N N N
vg0521749530 A -> C LOC_Os05g37200.3 upstream_gene_variant ; 1171.0bp to feature; MODIFIER silent_mutation Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808 N N N N
vg0521749530 A -> C LOC_Os05g37200.2 upstream_gene_variant ; 1171.0bp to feature; MODIFIER silent_mutation Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808 N N N N
vg0521749530 A -> C LOC_Os05g37190-LOC_Os05g37200 intergenic_region ; MODIFIER silent_mutation Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0521749530 A C -0.01 -0.01 -0.01 0.01 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521749530 NA 6.40E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 8.97E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 4.14E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 6.68E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 2.34E-06 8.43E-09 mr1227 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 1.96E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 3.50E-14 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 1.74E-28 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 9.78E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 8.33E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 1.32E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 2.31E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 NA 6.15E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 6.25E-06 NA mr1896 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530 8.13E-07 NA mr1896 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251