Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0520620647:

Variant ID: vg0520620647 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20620647
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CAACCGGTTTTTCCGCCACCTCGGTACGTGTTCGACATGTTACACATATTTGATCTGTTCATGTTTTACTGCTTAGTTTACATGTGTAGATCTAATGATG[T/C]
GTTAATGCTAGTATACATCTGTAATGTCATGATTTATTTATAGAATATATTAAATCATTATATGTCTATATTCTCAACATGCGTTTATAAGGGACGCTTT

Reverse complement sequence

AAAGCGTCCCTTATAAACGCATGTTGAGAATATAGACATATAATGATTTAATATATTCTATAAATAAATCATGACATTACAGATGTATACTAGCATTAAC[A/G]
CATCATTAGATCTACACATGTAAACTAAGCAGTAAAACATGAACAGATCAAATATGTGTAACATGTCGAACACGTACCGAGGTGGCGGAAAAACCGGTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.70%	28.10%	0.19%	0.00%	NA
All Indica	2759	97.90%	1.80%	0.29%	0.00%	NA
All Japonica	1512	19.30%	80.60%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	98.70%	1.20%	0.17%	0.00%	NA
Indica II	465	98.10%	1.50%	0.43%	0.00%	NA
Indica III	913	97.30%	2.50%	0.22%	0.00%	NA
Indica Intermediate	786	98.10%	1.50%	0.38%	0.00%	NA
Temperate Japonica	767	32.60%	67.30%	0.13%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	16.20%	83.80%	0.00%	0.00%	NA
VI/Aromatic	96	67.70%	32.30%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520620647	T -> C	LOC_Os05g34760.1	upstream_gene_variant ; 276.0bp to feature; MODIFIER	silent_mutation	Average:47.508; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N
vg0520620647	T -> C	LOC_Os05g34760.2	upstream_gene_variant ; 274.0bp to feature; MODIFIER	silent_mutation	Average:47.508; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N
vg0520620647	T -> C	LOC_Os05g34750.1	downstream_gene_variant ; 1807.0bp to feature; MODIFIER	silent_mutation	Average:47.508; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N
vg0520620647	T -> C	LOC_Os05g34750-LOC_Os05g34760	intergenic_region ; MODIFIER	silent_mutation	Average:47.508; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520620647	NA	3.69E-22	mr1913	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620647	NA	2.86E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620647	NA	4.02E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620647	NA	4.33E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620647	NA	1.20E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620647	NA	3.88E-31	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251