Variant ID: vg0520541556 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 20541556 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCAGTTAACAGATCAACCATTCCTTTTCTAACGCACAAATACATAATGAATTATTCTTTATAAATATTACCGAGATAAGTCCTCACAAAAATAGAAAAAA[A/C]
ACACACATAACTTATGATTTAAAAAATAAAGTAAATAGATTAATATCTTTGATTTTCGGTGTATGACGCTATTAACTTTAGGCATACATTTAACATATTT
AAATATGTTAAATGTATGCCTAAAGTTAATAGCGTCATACACCGAAAATCAAAGATATTAATCTATTTACTTTATTTTTTAAATCATAAGTTATGTGTGT[T/G]
TTTTTTCTATTTTTGTGAGGACTTATCTCGGTAATATTTATAAAGAATAATTCATTATGTATTTGTGCGTTAGAAAAGGAATGGTTGATCTGTTAACTGG
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.50% | 6.10% | 1.44% | 0.00% | NA |
All Indica | 2759 | 99.60% | 0.20% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 78.20% | 17.90% | 3.84% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.40% | 0.10% | 0.51% | 0.00% | NA |
Temperate Japonica | 767 | 97.80% | 1.60% | 0.65% | 0.00% | NA |
Tropical Japonica | 504 | 46.00% | 44.60% | 9.33% | 0.00% | NA |
Japonica Intermediate | 241 | 83.40% | 14.10% | 2.49% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
Intermediate | 90 | 83.30% | 12.20% | 4.44% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0520541556 | A -> C | LOC_Os05g34630.1 | upstream_gene_variant ; 1712.0bp to feature; MODIFIER | silent_mutation | Average:63.238; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
vg0520541556 | A -> C | LOC_Os05g34640.1 | upstream_gene_variant ; 814.0bp to feature; MODIFIER | silent_mutation | Average:63.238; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
vg0520541556 | A -> C | LOC_Os05g34630-LOC_Os05g34640 | intergenic_region ; MODIFIER | silent_mutation | Average:63.238; most accessible tissue: Callus, score: 90.875 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0520541556 | NA | 4.30E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520541556 | NA | 3.31E-15 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520541556 | NA | 5.60E-14 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520541556 | 4.52E-09 | 6.05E-19 | mr1301_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520541556 | 1.41E-07 | 4.20E-15 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520541556 | NA | 2.54E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520541556 | NA | 5.77E-12 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |