Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0520541556:

Variant ID: vg0520541556 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20541556
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAGTTAACAGATCAACCATTCCTTTTCTAACGCACAAATACATAATGAATTATTCTTTATAAATATTACCGAGATAAGTCCTCACAAAAATAGAAAAAA[A/C]
ACACACATAACTTATGATTTAAAAAATAAAGTAAATAGATTAATATCTTTGATTTTCGGTGTATGACGCTATTAACTTTAGGCATACATTTAACATATTT

Reverse complement sequence

AAATATGTTAAATGTATGCCTAAAGTTAATAGCGTCATACACCGAAAATCAAAGATATTAATCTATTTACTTTATTTTTTAAATCATAAGTTATGTGTGT[T/G]
TTTTTTCTATTTTTGTGAGGACTTATCTCGGTAATATTTATAAAGAATAATTCATTATGTATTTGTGCGTTAGAAAAGGAATGGTTGATCTGTTAACTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	6.10%	1.44%	0.00%	NA
All Indica	2759	99.60%	0.20%	0.18%	0.00%	NA
All Japonica	1512	78.20%	17.90%	3.84%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.10%	0.51%	0.00%	NA
Temperate Japonica	767	97.80%	1.60%	0.65%	0.00%	NA
Tropical Japonica	504	46.00%	44.60%	9.33%	0.00%	NA
Japonica Intermediate	241	83.40%	14.10%	2.49%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	83.30%	12.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520541556	A -> C	LOC_Os05g34630.1	upstream_gene_variant ; 1712.0bp to feature; MODIFIER	silent_mutation	Average:63.238; most accessible tissue: Callus, score: 90.875	N	N	N	N
vg0520541556	A -> C	LOC_Os05g34640.1	upstream_gene_variant ; 814.0bp to feature; MODIFIER	silent_mutation	Average:63.238; most accessible tissue: Callus, score: 90.875	N	N	N	N
vg0520541556	A -> C	LOC_Os05g34630-LOC_Os05g34640	intergenic_region ; MODIFIER	silent_mutation	Average:63.238; most accessible tissue: Callus, score: 90.875	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520541556	NA	4.30E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520541556	NA	3.31E-15	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520541556	NA	5.60E-14	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520541556	4.52E-09	6.05E-19	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520541556	1.41E-07	4.20E-15	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520541556	NA	2.54E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520541556	NA	5.77E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251