\
| Variant ID: vg0520392181 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 20392181 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGTTTTAATACCAAAATTTCACTTTGGATCATCATTTTCCAATCTTTTCACTTTAAAATAGGTAACTTTATCTTTGTTGCATAATAGACTATCACAAAC[C/T]
ACATCTGTAGCATGTCAACCACGTTGAGCACATTGGCAACGACATGCCGGCAAACTTTCACACTTATGCACATGCCAGATACCTTTTACCGGTGAAGATG
CATCTTCACCGGTAAAAGGTATCTGGCATGTGCATAAGTGTGAAAGTTTGCCGGCATGTCGTTGCCAATGTGCTCAACGTGGTTGACATGCTACAGATGT[G/A]
GTTTGTGATAGTCTATTATGCAACAAAGATAAAGTTACCTATTTTAAAGTGAAAAGATTGGAAAATGATGATCCAAAGTGAAATTTTGGTATTAAAACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.80% | 9.50% | 1.63% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 67.00% | 28.00% | 4.96% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 54.90% | 36.50% | 8.60% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.40% | 46.90% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0520392181 | C -> T | LOC_Os05g34400.1 | upstream_gene_variant ; 933.0bp to feature; MODIFIER | silent_mutation | Average:40.442; most accessible tissue: Callus, score: 72.026 | N | N | N | N |
| vg0520392181 | C -> T | LOC_Os05g34390.1 | downstream_gene_variant ; 1396.0bp to feature; MODIFIER | silent_mutation | Average:40.442; most accessible tissue: Callus, score: 72.026 | N | N | N | N |
| vg0520392181 | C -> T | LOC_Os05g34410.1 | downstream_gene_variant ; 3699.0bp to feature; MODIFIER | silent_mutation | Average:40.442; most accessible tissue: Callus, score: 72.026 | N | N | N | N |
| vg0520392181 | C -> T | LOC_Os05g34390-LOC_Os05g34400 | intergenic_region ; MODIFIER | silent_mutation | Average:40.442; most accessible tissue: Callus, score: 72.026 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0520392181 | NA | 6.56E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520392181 | NA | 3.59E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520392181 | NA | 8.32E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520392181 | NA | 1.10E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520392181 | NA | 2.67E-06 | mr1955 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520392181 | 1.05E-06 | 1.05E-06 | mr1955 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |