Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0520392181:

Variant ID: vg0520392181 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20392181
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTTTTAATACCAAAATTTCACTTTGGATCATCATTTTCCAATCTTTTCACTTTAAAATAGGTAACTTTATCTTTGTTGCATAATAGACTATCACAAAC[C/T]
ACATCTGTAGCATGTCAACCACGTTGAGCACATTGGCAACGACATGCCGGCAAACTTTCACACTTATGCACATGCCAGATACCTTTTACCGGTGAAGATG

Reverse complement sequence

CATCTTCACCGGTAAAAGGTATCTGGCATGTGCATAAGTGTGAAAGTTTGCCGGCATGTCGTTGCCAATGTGCTCAACGTGGTTGACATGCTACAGATGT[G/A]
GTTTGTGATAGTCTATTATGCAACAAAGATAAAGTTACCTATTTTAAAGTGAAAAGATTGGAAAATGATGATCCAAAGTGAAATTTTGGTATTAAAACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	9.50%	1.63%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.07%	0.00%	NA
All Japonica	1512	67.00%	28.00%	4.96%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	54.90%	36.50%	8.60%	0.00%	NA
Tropical Japonica	504	93.80%	6.20%	0.00%	0.00%	NA
Japonica Intermediate	241	49.40%	46.90%	3.73%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520392181	C -> T	LOC_Os05g34400.1	upstream_gene_variant ; 933.0bp to feature; MODIFIER	silent_mutation	Average:40.442; most accessible tissue: Callus, score: 72.026	N	N	N	N
vg0520392181	C -> T	LOC_Os05g34390.1	downstream_gene_variant ; 1396.0bp to feature; MODIFIER	silent_mutation	Average:40.442; most accessible tissue: Callus, score: 72.026	N	N	N	N
vg0520392181	C -> T	LOC_Os05g34410.1	downstream_gene_variant ; 3699.0bp to feature; MODIFIER	silent_mutation	Average:40.442; most accessible tissue: Callus, score: 72.026	N	N	N	N
vg0520392181	C -> T	LOC_Os05g34390-LOC_Os05g34400	intergenic_region ; MODIFIER	silent_mutation	Average:40.442; most accessible tissue: Callus, score: 72.026	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520392181	NA	6.56E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181	NA	3.59E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181	NA	8.32E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181	NA	1.10E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181	NA	2.67E-06	mr1955	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181	1.05E-06	1.05E-06	mr1955	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251