\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520392181:

Variant ID: vg0520392181 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20392181
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTTTTAATACCAAAATTTCACTTTGGATCATCATTTTCCAATCTTTTCACTTTAAAATAGGTAACTTTATCTTTGTTGCATAATAGACTATCACAAAC[C/T]
ACATCTGTAGCATGTCAACCACGTTGAGCACATTGGCAACGACATGCCGGCAAACTTTCACACTTATGCACATGCCAGATACCTTTTACCGGTGAAGATG

Reverse complement sequence

CATCTTCACCGGTAAAAGGTATCTGGCATGTGCATAAGTGTGAAAGTTTGCCGGCATGTCGTTGCCAATGTGCTCAACGTGGTTGACATGCTACAGATGT[G/A]
GTTTGTGATAGTCTATTATGCAACAAAGATAAAGTTACCTATTTTAAAGTGAAAAGATTGGAAAATGATGATCCAAAGTGAAATTTTGGTATTAAAACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 9.50% 1.63% 0.00% NA
All Indica  2759 99.70% 0.30% 0.07% 0.00% NA
All Japonica  1512 67.00% 28.00% 4.96% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 54.90% 36.50% 8.60% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 49.40% 46.90% 3.73% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520392181 C -> T LOC_Os05g34400.1 upstream_gene_variant ; 933.0bp to feature; MODIFIER silent_mutation Average:40.442; most accessible tissue: Callus, score: 72.026 N N N N
vg0520392181 C -> T LOC_Os05g34390.1 downstream_gene_variant ; 1396.0bp to feature; MODIFIER silent_mutation Average:40.442; most accessible tissue: Callus, score: 72.026 N N N N
vg0520392181 C -> T LOC_Os05g34410.1 downstream_gene_variant ; 3699.0bp to feature; MODIFIER silent_mutation Average:40.442; most accessible tissue: Callus, score: 72.026 N N N N
vg0520392181 C -> T LOC_Os05g34390-LOC_Os05g34400 intergenic_region ; MODIFIER silent_mutation Average:40.442; most accessible tissue: Callus, score: 72.026 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520392181 NA 6.56E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181 NA 3.59E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181 NA 8.32E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181 NA 1.10E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181 NA 2.67E-06 mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520392181 1.05E-06 1.05E-06 mr1955 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251