\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520118958:

Variant ID: vg0520118958 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20118958
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATATATAAACGGACTACTAAAACGACGCATAGAAATTAGACTTTTTCCGCCGCACTTTTTTCCGCCCTTTTTATTTTTTTTTCTTGTGTATTTTTTT[T/A]
CGAACCGTTTTTTTCACCACTTTCTTATAATATCGGACCTTTCTAGATAAAATAGGATTTTTTTTACCGCGTCACATATAATTTCTTTTTCTCGGAATTG

Reverse complement sequence

CAATTCCGAGAAAAAGAAATTATATGTGACGCGGTAAAAAAAATCCTATTTTATCTAGAAAGGTCCGATATTATAAGAAAGTGGTGAAAAAAACGGTTCG[A/T]
AAAAAAATACACAAGAAAAAAAAATAAAAAGGGCGGAAAAAAGTGCGGCGGAAAAAGTCTAATTTCTATGCGTCGTTTTAGTAGTCCGTTTATATATCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 13.60% 2.48% 0.80% NA
All Indica  2759 94.50% 1.60% 2.54% 1.34% NA
All Japonica  1512 72.80% 24.30% 2.91% 0.00% NA
Aus  269 17.50% 82.50% 0.00% 0.00% NA
Indica I  595 98.20% 0.30% 1.51% 0.00% NA
Indica II  465 94.20% 1.10% 3.01% 1.72% NA
Indica III  913 92.60% 1.50% 3.40% 2.52% NA
Indica Intermediate  786 94.30% 2.90% 2.04% 0.76% NA
Temperate Japonica  767 51.40% 44.10% 4.56% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 11.60% 3.73% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 86.70% 8.90% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520118958 T -> DEL N N silent_mutation Average:22.301; most accessible tissue: Callus, score: 47.397 N N N N
vg0520118958 T -> A LOC_Os05g34050.1 upstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:22.301; most accessible tissue: Callus, score: 47.397 N N N N
vg0520118958 T -> A LOC_Os05g34060.1 upstream_gene_variant ; 2318.0bp to feature; MODIFIER silent_mutation Average:22.301; most accessible tissue: Callus, score: 47.397 N N N N
vg0520118958 T -> A LOC_Os05g34050-LOC_Os05g34060 intergenic_region ; MODIFIER silent_mutation Average:22.301; most accessible tissue: Callus, score: 47.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520118958 NA 9.32E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 8.17E-07 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 4.34E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 1.92E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 1.28E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 1.38E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 6.08E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 6.55E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 8.60E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 1.41E-08 mr1614 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 1.13E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 9.24E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 2.90E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 1.32E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520118958 NA 9.43E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251