Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520054493:

Variant ID: vg0520054493 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20054493
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAGAGTCCGTACAAAAATACAATTTACAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCAATATAGGAATACAATTTA[G/T]
AAGTAACTGAAATTTAAAATTTAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTGCACATAGAAATACAATTAGAAATAATAAAAATTCAGAATTAAA

Reverse complement sequence

TTTAATTCTGAATTTTTATTATTTCTAATTGTATTTCTATGTGCACTCTAAACTCATCTTTCAATATTCTTTAATTTTAAATTTTAAATTTCAGTTACTT[C/A]
TAAATTGTATTCCTATATTGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTGTAAATTGTATTTTTGTACGGACTCTAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	5.50%	0.00%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	17.80%	82.20%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	98.40%	1.60%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520054493	G -> T	LOC_Os05g33960.1	upstream_gene_variant ; 3691.0bp to feature; MODIFIER	silent_mutation	Average:19.372; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0520054493	G -> T	LOC_Os05g33970.1	upstream_gene_variant ; 853.0bp to feature; MODIFIER	silent_mutation	Average:19.372; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0520054493	G -> T	LOC_Os05g33960-LOC_Os05g33970	intergenic_region ; MODIFIER	silent_mutation	Average:19.372; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520054493	NA	2.49E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	1.70E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	3.92E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	9.13E-08	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	7.75E-18	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	5.10E-23	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	5.16E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	2.68E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	4.53E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	1.44E-07	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	8.19E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	2.80E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	2.81E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	3.49E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	1.13E-06	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	2.39E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	1.52E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	6.98E-07	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	1.13E-06	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	9.90E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	1.43E-06	4.06E-16	mr1612	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	7.62E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	1.36E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	2.02E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	7.56E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520054493	NA	8.21E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251