\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519821208:

Variant ID: vg0519821208 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19821208
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.15, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATTTGTTTTTTCTTAAAATAAAGATATAGTGGTTAAAAATAATGGGTCCACCAGATTAAATAAAAACCGATGGTTGGATGTTAAAGCTCCACGTGCC[G/A]
ATCTAGGAGCGTTTGTAGGAGCGCCACGTGGCGGCTCGAGAGCGTTTGTAGAAAGTTTAATGGACTTTTAGTATATAATAGATAGATAGATAGATACTTC

Reverse complement sequence

GAAGTATCTATCTATCTATCTATTATATACTAAAAGTCCATTAAACTTTCTACAAACGCTCTCGAGCCGCCACGTGGCGCTCCTACAAACGCTCCTAGAT[C/T]
GGCACGTGGAGCTTTAACATCCAACCATCGGTTTTTATTTAATCTGGTGGACCCATTATTTTTAACCACTATATCTTTATTTTAAGAAAAAACAAATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.20% 17.30% 2.54% 4.00% NA
All Indica  2759 61.00% 28.20% 4.24% 6.63% NA
All Japonica  1512 99.20% 0.70% 0.07% 0.07% NA
Aus  269 91.80% 7.10% 0.37% 0.74% NA
Indica I  595 41.00% 36.50% 7.23% 15.29% NA
Indica II  465 60.00% 24.70% 4.30% 10.97% NA
Indica III  913 67.90% 28.90% 1.86% 1.31% NA
Indica Intermediate  786 68.60% 23.00% 4.71% 3.69% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.20% 0.20% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 11.10% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519821208 G -> DEL N N silent_mutation Average:51.537; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0519821208 G -> A LOC_Os05g33680.1 downstream_gene_variant ; 3436.0bp to feature; MODIFIER silent_mutation Average:51.537; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0519821208 G -> A LOC_Os05g33680-LOC_Os05g33690 intergenic_region ; MODIFIER silent_mutation Average:51.537; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519821208 NA 4.51E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 1.61E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 7.75E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 5.09E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 1.14E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 6.75E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 9.40E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 1.13E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 2.58E-06 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 1.49E-06 mr1336_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 1.01E-06 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519821208 NA 4.01E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251