Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0519750092:

Variant ID: vg0519750092 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19750092
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGGAAGTAGTGGGAGAAACGTTACATCGCTGGTCAAGGACCAGGCAGTAGTCGTAACTCGACCACTTGAAGTGAAAGTAGTGGAAGAAACACTACATC[A/G]
CTGGTCGAGGACCAGGCAGTAGTCGTAACTCGACCACTTAAAGTGGAAGTAGTGGGAGAAACGCTGCATCGCTGGTCGAGGACCAAGCAGTAGTTGTAAC

Reverse complement sequence

GTTACAACTACTGCTTGGTCCTCGACCAGCGATGCAGCGTTTCTCCCACTACTTCCACTTTAAGTGGTCGAGTTACGACTACTGCCTGGTCCTCGACCAG[T/C]
GATGTAGTGTTTCTTCCACTACTTTCACTTCAAGTGGTCGAGTTACGACTACTGCCTGGTCCTTGACCAGCGATGTAACGTTTCTCCCACTACTTCCACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 21.50% 17.63% 1.23% NA
All Indica  2759 63.60% 19.20% 17.00% 0.22% NA
All Japonica  1512 64.60% 9.10% 22.95% 3.37% NA
Aus  269 11.20% 87.70% 0.74% 0.37% NA
Indica I  595 51.10% 30.10% 18.66% 0.17% NA
Indica II  465 54.20% 20.90% 24.73% 0.22% NA
Indica III  913 72.90% 10.40% 16.65% 0.00% NA
Indica Intermediate  786 67.70% 20.20% 11.58% 0.51% NA
Temperate Japonica  767 97.50% 1.20% 0.78% 0.52% NA
Tropical Japonica  504 8.30% 22.60% 61.71% 7.34% NA
Japonica Intermediate  241 77.20% 6.20% 12.45% 4.15% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 57.80% 26.70% 15.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519750092 A -> DEL N N silent_mutation Average:26.785; most accessible tissue: Minghui63 flag leaf, score: 38.911 N N N N
vg0519750092 A -> G LOC_Os05g33590-LOC_Os05g33600 intergenic_region ; MODIFIER silent_mutation Average:26.785; most accessible tissue: Minghui63 flag leaf, score: 38.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519750092 NA 4.42E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0519750092 NA 3.18E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 3.06E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 2.42E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 2.56E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 3.83E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.37E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 6.27E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 2.30E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 2.81E-17 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.59E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 8.78E-10 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 8.56E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.12E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 2.74E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.91E-13 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.87E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 7.25E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 5.05E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.76E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 7.08E-16 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.12E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 2.28E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 4.91E-06 5.32E-15 mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 2.42E-27 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 4.46E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 5.78E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 3.54E-18 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 7.93E-06 mr1719_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 3.88E-06 mr1719_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 5.40E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.48E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 1.41E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 3.47E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519750092 NA 2.01E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251