\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519573025:

Variant ID: vg0519573025 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19573025
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGATCCCCCCTCGGGGGGGAGCCATGTGGCGCCTGGGGCGGCCTTCTCCCTCTAGTCTTGGCTAGGGAGTGGCCGCCGCCCTACCTCGGGCCCGACCCC[T/C]
CTCGGGGGAGGGCCACGTGGCATTGGAGGACAGCCTCCTCCATCCAGTCTCTAGGAAGGAGTGGCCGTCGTCCTACCTCGGGCCTGACTGCCCTCGGGGG

Reverse complement sequence

CCCCCGAGGGCAGTCAGGCCCGAGGTAGGACGACGGCCACTCCTTCCTAGAGACTGGATGGAGGAGGCTGTCCTCCAATGCCACGTGGCCCTCCCCCGAG[A/G]
GGGGTCGGGCCCGAGGTAGGGCGGCGGCCACTCCCTAGCCAAGACTAGAGGGAGAAGGCCGCCCCAGGCGCCACATGGCTCCCCCCCGAGGGGGGATCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 0.20% 14.54% 30.30% NA
All Indica  2759 43.50% 0.10% 13.95% 42.44% NA
All Japonica  1512 81.30% 0.00% 3.04% 15.67% NA
Aus  269 14.10% 2.20% 82.53% 1.12% NA
Indica I  595 22.50% 0.00% 3.70% 73.78% NA
Indica II  465 51.00% 0.40% 30.32% 18.28% NA
Indica III  913 45.90% 0.10% 12.38% 41.62% NA
Indica Intermediate  786 52.20% 0.00% 13.87% 33.97% NA
Temperate Japonica  767 97.90% 0.00% 0.26% 1.83% NA
Tropical Japonica  504 54.20% 0.00% 8.33% 37.50% NA
Japonica Intermediate  241 85.10% 0.00% 0.83% 14.11% NA
VI/Aromatic  96 70.80% 0.00% 17.71% 11.46% NA
Intermediate  90 70.00% 0.00% 18.89% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519573025 T -> DEL N N silent_mutation Average:19.007; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0519573025 T -> C LOC_Os05g33340.1 upstream_gene_variant ; 3821.0bp to feature; MODIFIER silent_mutation Average:19.007; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0519573025 T -> C LOC_Os05g33340-LOC_Os05g33350 intergenic_region ; MODIFIER silent_mutation Average:19.007; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519573025 NA 4.85E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 4.88E-06 mr1297 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 1.43E-06 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 6.87E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 5.25E-06 mr1500 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 7.49E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 3.09E-06 mr1668 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 1.06E-06 mr1749 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 1.12E-08 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 6.87E-07 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 9.93E-06 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 6.71E-07 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 5.42E-06 5.42E-06 mr1941 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 2.00E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 2.98E-07 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 2.41E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 2.30E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519573025 NA 9.71E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251