Variant ID: vg0519391556 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 19391556 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTAGAGAGGAAAAAGAAATAACTTGCATAATACACACGGAAATGCTATTTGGTGATCGATTGCCCTGGGGATGGGGCAGCGATCGATCCCCTCCCCCCTC[C/T]
CTCCCTCCAACCCTCCACCTGGTTTCCTCTTTTGGCACCGCATTACTTTCCTATTTTAGTAAATTTATACACCTCAAGTTTACACATCTAAACTTTAGAG
CTCTAAAGTTTAGATGTGTAAACTTGAGGTGTATAAATTTACTAAAATAGGAAAGTAATGCGGTGCCAAAAGAGGAAACCAGGTGGAGGGTTGGAGGGAG[G/A]
GAGGGGGGAGGGGATCGATCGCTGCCCCATCCCCAGGGCAATCGATCACCAAATAGCATTTCCGTGTGTATTATGCAAGTTATTTCTTTTTCCTCTCTAG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 78.60% | 21.20% | 0.19% | 0.00% | NA |
All Indica | 2759 | 67.10% | 32.70% | 0.29% | 0.00% | NA |
All Japonica | 1512 | 98.10% | 1.90% | 0.07% | 0.00% | NA |
Aus | 269 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 84.50% | 15.00% | 0.50% | 0.00% | NA |
Indica II | 465 | 55.90% | 44.10% | 0.00% | 0.00% | NA |
Indica III | 913 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 63.10% | 36.30% | 0.64% | 0.00% | NA |
Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.60% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0519391556 | C -> T | LOC_Os05g33070.1 | upstream_gene_variant ; 3202.0bp to feature; MODIFIER | silent_mutation | Average:34.433; most accessible tissue: Callus, score: 66.623 | N | N | N | N |
vg0519391556 | C -> T | LOC_Os05g33060-LOC_Os05g33070 | intergenic_region ; MODIFIER | silent_mutation | Average:34.433; most accessible tissue: Callus, score: 66.623 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0519391556 | NA | 4.81E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519391556 | NA | 8.11E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519391556 | NA | 3.41E-06 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519391556 | NA | 1.20E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519391556 | NA | 7.93E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519391556 | NA | 1.79E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519391556 | NA | 6.61E-06 | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519391556 | NA | 6.17E-07 | mr1959_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |