\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519391556:

Variant ID: vg0519391556 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19391556
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGAGAGGAAAAAGAAATAACTTGCATAATACACACGGAAATGCTATTTGGTGATCGATTGCCCTGGGGATGGGGCAGCGATCGATCCCCTCCCCCCTC[C/T]
CTCCCTCCAACCCTCCACCTGGTTTCCTCTTTTGGCACCGCATTACTTTCCTATTTTAGTAAATTTATACACCTCAAGTTTACACATCTAAACTTTAGAG

Reverse complement sequence

CTCTAAAGTTTAGATGTGTAAACTTGAGGTGTATAAATTTACTAAAATAGGAAAGTAATGCGGTGCCAAAAGAGGAAACCAGGTGGAGGGTTGGAGGGAG[G/A]
GAGGGGGGAGGGGATCGATCGCTGCCCCATCCCCAGGGCAATCGATCACCAAATAGCATTTCCGTGTGTATTATGCAAGTTATTTCTTTTTCCTCTCTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.20% 0.19% 0.00% NA
All Indica  2759 67.10% 32.70% 0.29% 0.00% NA
All Japonica  1512 98.10% 1.90% 0.07% 0.00% NA
Aus  269 82.90% 17.10% 0.00% 0.00% NA
Indica I  595 84.50% 15.00% 0.50% 0.00% NA
Indica II  465 55.90% 44.10% 0.00% 0.00% NA
Indica III  913 64.70% 35.30% 0.00% 0.00% NA
Indica Intermediate  786 63.10% 36.30% 0.64% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519391556 C -> T LOC_Os05g33070.1 upstream_gene_variant ; 3202.0bp to feature; MODIFIER silent_mutation Average:34.433; most accessible tissue: Callus, score: 66.623 N N N N
vg0519391556 C -> T LOC_Os05g33060-LOC_Os05g33070 intergenic_region ; MODIFIER silent_mutation Average:34.433; most accessible tissue: Callus, score: 66.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519391556 NA 4.81E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519391556 NA 8.11E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519391556 NA 3.41E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519391556 NA 1.20E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519391556 NA 7.93E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519391556 NA 1.79E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519391556 NA 6.61E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519391556 NA 6.17E-07 mr1959_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251