\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519154442:

Variant ID: vg0519154442 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19154442
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCCCGTCAACACCAACGGAGGCAATACTACCTCAAACTCCAATGGAGAACCATTCTTGAGGTATAACCTTCTTACATTATTTCAATTAGAAGTTTTAC[G/T]
GTTAATGTTGATCGCAATGTCAACATTGTGCTATCATGTGATTGTTGATGCTTATTCTACGTTAATTATGCTCATGTTGATTACATTCACCACTATCACT

Reverse complement sequence

AGTGATAGTGGTGAATGTAATCAACATGAGCATAATTAACGTAGAATAAGCATCAACAATCACATGATAGCACAATGTTGACATTGCGATCAACATTAAC[C/A]
GTAAAACTTCTAATTGAAATAATGTAAGAAGGTTATACCTCAAGAATGGTTCTCCATTGGAGTTTGAGGTAGTATTGCCTCCGTTGGTGTTGACGGGAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 11.50% 0.89% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 62.40% 35.10% 2.58% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 31.90% 64.00% 4.04% 0.00% NA
Tropical Japonica  504 97.60% 1.40% 0.99% 0.00% NA
Japonica Intermediate  241 85.50% 13.30% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519154442 G -> T LOC_Os05g32700.1 downstream_gene_variant ; 1332.0bp to feature; MODIFIER silent_mutation Average:48.844; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0519154442 G -> T LOC_Os05g32710.1 downstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:48.844; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0519154442 G -> T LOC_Os05g32700-LOC_Os05g32710 intergenic_region ; MODIFIER silent_mutation Average:48.844; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519154442 NA 4.33E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 1.37E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 6.11E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 9.77E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 3.76E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 1.22E-06 NA mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 2.00E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 1.65E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 4.23E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 2.90E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 8.07E-10 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519154442 NA 4.73E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251