Variant ID: vg0519154442 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 19154442 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 254. )
GTTCCCGTCAACACCAACGGAGGCAATACTACCTCAAACTCCAATGGAGAACCATTCTTGAGGTATAACCTTCTTACATTATTTCAATTAGAAGTTTTAC[G/T]
GTTAATGTTGATCGCAATGTCAACATTGTGCTATCATGTGATTGTTGATGCTTATTCTACGTTAATTATGCTCATGTTGATTACATTCACCACTATCACT
AGTGATAGTGGTGAATGTAATCAACATGAGCATAATTAACGTAGAATAAGCATCAACAATCACATGATAGCACAATGTTGACATTGCGATCAACATTAAC[C/A]
GTAAAACTTCTAATTGAAATAATGTAAGAAGGTTATACCTCAAGAATGGTTCTCCATTGGAGTTTGAGGTAGTATTGCCTCCGTTGGTGTTGACGGGAAC
Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 87.60% | 11.50% | 0.89% | 0.00% | NA |
All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 62.40% | 35.10% | 2.58% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 31.90% | 64.00% | 4.04% | 0.00% | NA |
Tropical Japonica | 504 | 97.60% | 1.40% | 0.99% | 0.00% | NA |
Japonica Intermediate | 241 | 85.50% | 13.30% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0519154442 | G -> T | LOC_Os05g32700.1 | downstream_gene_variant ; 1332.0bp to feature; MODIFIER | silent_mutation | Average:48.844; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
vg0519154442 | G -> T | LOC_Os05g32710.1 | downstream_gene_variant ; 528.0bp to feature; MODIFIER | silent_mutation | Average:48.844; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
vg0519154442 | G -> T | LOC_Os05g32700-LOC_Os05g32710 | intergenic_region ; MODIFIER | silent_mutation | Average:48.844; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0519154442 | NA | 4.33E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 1.37E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 6.11E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 9.77E-10 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 3.76E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | 1.22E-06 | NA | mr1174_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 2.00E-08 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 1.65E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 4.23E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 2.90E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 8.07E-10 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0519154442 | NA | 4.73E-09 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |