Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519079761:

Variant ID: vg0519079761 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19079761
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAAAAATGGGGAAACTCAGCCATCGATATACGCTCTTATTATGTTGTAAACAGGAGCATTGTGTTCAAACCGCTCGATAATTCAACCATGTTTTTTTT[A/T]
AAAAAAATCTACTAATAATTTATTTAAAATTTACCAGTTTTCATGGATGACTTAAGGGTTATTGCGGTTATTGATAAAACCATGAATATGTTCATCGTAA

Reverse complement sequence

TTACGATGAACATATTCATGGTTTTATCAATAACCGCAATAACCCTTAAGTCATCCATGAAAACTGGTAAATTTTAAATAAATTATTAGTAGATTTTTTT[T/A]
AAAAAAAACATGGTTGAATTATCGAGCGGTTTGAACACAATGCTCCTGTTTACAACATAATAAGAGCGTATATCGATGGCTGAGTTTCCCCATTTTTTTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	29.80%	3.00%	0.00%	NA
All Indica	2759	58.90%	36.80%	4.35%	0.00%	NA
All Japonica	1512	88.10%	11.40%	0.46%	0.00%	NA
Aus	269	20.40%	75.80%	3.72%	0.00%	NA
Indica I	595	26.10%	62.50%	11.43%	0.00%	NA
Indica II	465	60.90%	36.80%	2.37%	0.00%	NA
Indica III	913	72.80%	25.60%	1.53%	0.00%	NA
Indica Intermediate	786	66.40%	30.20%	3.44%	0.00%	NA
Temperate Japonica	767	98.60%	1.30%	0.13%	0.00%	NA
Tropical Japonica	504	73.00%	26.00%	0.99%	0.00%	NA
Japonica Intermediate	241	86.30%	13.30%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	80.00%	14.40%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519079761	A -> T	LOC_Os05g32590.1	upstream_gene_variant ; 1243.0bp to feature; MODIFIER	silent_mutation	Average:53.634; most accessible tissue: Callus, score: 79.11	N	N	N	N
vg0519079761	A -> T	LOC_Os05g32600.1	upstream_gene_variant ; 4147.0bp to feature; MODIFIER	silent_mutation	Average:53.634; most accessible tissue: Callus, score: 79.11	N	N	N	N
vg0519079761	A -> T	LOC_Os05g32600.2	upstream_gene_variant ; 4130.0bp to feature; MODIFIER	silent_mutation	Average:53.634; most accessible tissue: Callus, score: 79.11	N	N	N	N
vg0519079761	A -> T	LOC_Os05g32580.1	downstream_gene_variant ; 1469.0bp to feature; MODIFIER	silent_mutation	Average:53.634; most accessible tissue: Callus, score: 79.11	N	N	N	N
vg0519079761	A -> T	LOC_Os05g32580.2	downstream_gene_variant ; 1469.0bp to feature; MODIFIER	silent_mutation	Average:53.634; most accessible tissue: Callus, score: 79.11	N	N	N	N
vg0519079761	A -> T	LOC_Os05g32580.3	downstream_gene_variant ; 1450.0bp to feature; MODIFIER	silent_mutation	Average:53.634; most accessible tissue: Callus, score: 79.11	N	N	N	N
vg0519079761	A -> T	LOC_Os05g32580-LOC_Os05g32590	intergenic_region ; MODIFIER	silent_mutation	Average:53.634; most accessible tissue: Callus, score: 79.11	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519079761	NA	1.33E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	2.89E-06	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	1.57E-06	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	8.53E-06	mr1049_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	5.97E-06	mr1131_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	3.12E-06	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	9.86E-06	mr1199_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	8.41E-06	mr1321_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	3.06E-06	3.19E-09	mr1322_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	1.63E-06	mr1324_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	1.23E-07	1.85E-10	mr1325_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	4.31E-06	4.88E-09	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	4.42E-09	mr1333_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	1.61E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	5.19E-06	mr1346_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519079761	NA	6.87E-06	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251