\
| Variant ID: vg0518026034 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 18026034 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 109. )
TTGAGAACGTTCCTGTTAAGGGAGCAGGAGTTAAACCGGACATACTTCTATCACCATGAATTCATCAACCATAATACCATATGGAGTACTCCATCCATCC[C/T]
AAAATATAAGCATTTTAGAATAGTGCCAAGTCAAACACTTTTAACTTTAACTATTAATAGCATAGAAATTAAAAAGATCAATCATGTAAAATTGATATTA
TAATATCAATTTTACATGATTGATCTTTTTAATTTCTATGCTATTAATAGTTAAAGTTAAAAGTGTTTGACTTGGCACTATTCTAAAATGCTTATATTTT[G/A]
GGATGGATGGAGTACTCCATATGGTATTATGGTTGATGAATTCATGGTGATAGAAGTATGTCCGGTTTAACTCCTGCTCCCTTAACAGGAACGTTCTCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.20% | 37.40% | 0.13% | 0.32% | NA |
| All Indica | 2759 | 91.20% | 8.40% | 0.07% | 0.29% | NA |
| All Japonica | 1512 | 19.00% | 80.40% | 0.26% | 0.40% | NA |
| Aus | 269 | 33.10% | 66.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.50% | 26.20% | 0.22% | 1.08% | NA |
| Indica III | 913 | 95.00% | 4.80% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 91.20% | 8.50% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 12.90% | 86.70% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 24.20% | 75.20% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 27.40% | 71.00% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0518026034 | C -> T | LOC_Os05g31020-LOC_Os05g31040 | intergenic_region ; MODIFIER | silent_mutation | Average:60.699; most accessible tissue: Callus, score: 83.599 | N | N | N | N |
| vg0518026034 | C -> DEL | N | N | silent_mutation | Average:60.699; most accessible tissue: Callus, score: 83.599 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0518026034 | NA | 1.11E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 1.37E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 3.88E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 1.34E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 3.65E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 2.46E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 2.75E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 2.92E-06 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 4.35E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 4.56E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 1.72E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | 4.33E-07 | 1.84E-13 | mr1827 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518026034 | NA | 6.46E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |