Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517977616:

Variant ID: vg0517977616 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17977616
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCCATAAGTCACTTGAAGTTTGACATTCTACCCCATAAGTCATTTTGTTGCAAATACCCATCCGCTACTAAGTTTTGTTGCAAAAACCACCCCAATACG[T/C]
GCGTGCTTAACAGAATCAGTTCGTTATTGATGATGTAGGGTTACTACATGCTTAGCTAAGTCAATCTTGTCCAAGTGCTTACATTAGACTTATTTTCCAT

Reverse complement sequence

ATGGAAAATAAGTCTAATGTAAGCACTTGGACAAGATTGACTTAGCTAAGCATGTAGTAACCCTACATCATCAATAACGAACTGATTCTGTTAAGCACGC[A/G]
CGTATTGGGGTGGTTTTTGCAACAAAACTTAGTAGCGGATGGGTATTTGCAACAAAATGACTTATGGGGTAGAATGTCAAACTTCAAGTGACTTATGGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 17.90% 0.17% 16.40% NA
All Indica  2759 94.70% 0.50% 0.07% 4.71% NA
All Japonica  1512 9.80% 48.20% 0.40% 41.60% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 75.90% 1.30% 0.43% 22.37% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 0.40% 0.00% 3.31% NA
Temperate Japonica  767 3.30% 76.00% 0.39% 20.34% NA
Tropical Japonica  504 21.60% 17.50% 0.00% 60.91% NA
Japonica Intermediate  241 5.80% 24.10% 1.24% 68.88% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 63.30% 18.90% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517977616 T -> DEL N N silent_mutation Average:47.403; most accessible tissue: Zhenshan97 root, score: 63.237 N N N N
vg0517977616 T -> C LOC_Os05g30960.1 upstream_gene_variant ; 534.0bp to feature; MODIFIER silent_mutation Average:47.403; most accessible tissue: Zhenshan97 root, score: 63.237 N N N N
vg0517977616 T -> C LOC_Os05g30950-LOC_Os05g30960 intergenic_region ; MODIFIER silent_mutation Average:47.403; most accessible tissue: Zhenshan97 root, score: 63.237 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517977616 NA 3.17E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 9.86E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 9.77E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 1.83E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 5.68E-06 5.53E-08 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 2.14E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 9.36E-10 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 1.28E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 8.25E-06 NA mr1622_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 2.74E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 7.42E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 1.05E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 3.43E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 1.42E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 2.98E-10 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 6.23E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 5.01E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 1.05E-10 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 4.55E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 9.91E-07 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 1.13E-08 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 1.03E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 4.73E-06 NA mr1851_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 3.65E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 1.91E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 7.94E-06 NA mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 9.53E-11 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 2.65E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 5.29E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 3.82E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 NA 2.54E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977616 2.10E-06 4.31E-07 mr1974_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251