\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517793133:

Variant ID: vg0517793133 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17793133
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGCTATAAATTTCATATAAAATTTGTCCTAATCCGTGTCCATATGAAAAGAATAAGTTAAATTATGAGATGATAAATTTTTATTGCAACGAATTTGTT[A/G,T]
ATCATGGCAATAGAAAATAGTGAAAAGTACCATGTACTATGCAAATTGCCACAAAAATTAAATGTGTGGCGATAGAACATGTTTTTGCAATAGTACTGTT

Reverse complement sequence

AACAGTACTATTGCAAAAACATGTTCTATCGCCACACATTTAATTTTTGTGGCAATTTGCATAGTACATGGTACTTTTCACTATTTTCTATTGCCATGAT[T/C,A]
AACAAATTCGTTGCAATAAAAATTTATCATCTCATAATTTAACTTATTCTTTTCATATGGACACGGATTAGGACAAATTTTATATGAAATTTATAGCTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 6.00% 1.10% 52.50% T: 0.04%
All Indica  2759 14.00% 2.10% 1.67% 82.17% T: 0.04%
All Japonica  1512 91.30% 0.20% 0.20% 8.20% T: 0.07%
Aus  269 2.60% 75.50% 0.37% 21.56% NA
Indica I  595 16.50% 3.40% 2.69% 77.48% NA
Indica II  465 34.00% 0.40% 1.08% 64.52% NA
Indica III  913 2.30% 1.20% 0.77% 95.73% NA
Indica Intermediate  786 14.00% 3.20% 2.29% 80.41% T: 0.13%
Temperate Japonica  767 97.00% 0.10% 0.26% 2.48% T: 0.13%
Tropical Japonica  504 79.80% 0.00% 0.00% 20.24% NA
Japonica Intermediate  241 97.50% 0.80% 0.41% 1.24% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 51.10% 11.10% 2.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517793133 A -> T LOC_Os05g30720.1 downstream_gene_variant ; 1871.0bp to feature; MODIFIER silent_mutation Average:7.649; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0517793133 A -> T LOC_Os05g30730.1 downstream_gene_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:7.649; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0517793133 A -> T LOC_Os05g30720-LOC_Os05g30730 intergenic_region ; MODIFIER silent_mutation Average:7.649; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0517793133 A -> G LOC_Os05g30720.1 downstream_gene_variant ; 1871.0bp to feature; MODIFIER silent_mutation Average:7.649; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0517793133 A -> G LOC_Os05g30730.1 downstream_gene_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:7.649; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0517793133 A -> G LOC_Os05g30720-LOC_Os05g30730 intergenic_region ; MODIFIER silent_mutation Average:7.649; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0517793133 A -> DEL N N silent_mutation Average:7.649; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517793133 NA 3.68E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 3.27E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 7.19E-09 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 6.24E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 3.90E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.65E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 2.94E-23 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.51E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.42E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 6.54E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 9.57E-10 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 2.15E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.82E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 7.92E-09 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 7.22E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 9.49E-09 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 4.29E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 5.30E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 2.50E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.59E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 2.14E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 5.42E-12 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 6.93E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 9.13E-13 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 6.16E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 3.62E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 2.13E-09 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 3.65E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 2.64E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 4.13E-19 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.34E-25 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.25E-25 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.00E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 4.31E-11 mr1989 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 1.15E-21 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 7.81E-12 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 8.75E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 2.96E-13 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 8.51E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 3.15E-12 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 4.78E-23 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 3.37E-11 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 5.48E-14 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 3.20E-19 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517793133 NA 5.40E-16 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251